AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i137_tpal_bbur_100.orf -o137_tpal_bbur_100.ace -a/home/amcguire/genomes/ORF_tpal.txt -z/home/amcguire/genomes/synecho.fna -g0.40 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.4 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RTP00721 95 AE000520 #2 RTP00722 90 AE000520 #3 RTP00723 31 AE000520 Motif number 1 AATTCTGTCGTGAACGCGAAGCCGTTG 1 6 0 TGAACCGAAC 0.990552 -90 ACGACAGAATTAGACGCGGGGCTTGCCTTTCT 1 27 1 TAGACCGGGC 0.951724 -69 CACCAGGAACTGCGCACGGAACATAAGAAAGG 1 52 0 TGCGCCGGAC 0.995719 -44 CGGTTCCATGTGGGCTCGAAAAGGG 2 4 0 TGGGCCGAAA 0.992281 -87 CGAGCCCACATGGAACCGGACCCATATCGATT 2 18 1 TGGAACGGAC 0.995568 -73 TTGAAATTACTGCAAGCGAATCACTAGGTGTC 2 53 1 TGCAACGAAC 0.989761 -38 GCGAATCACTAGGTGTCGAAAACCGCGGCGGT 2 68 1 AGGTGCGAAA 0.886215 -23 AGGTGGTGTCGAAACTCGTGCGCCC 3 17 0 TGGTGCGAAC 0.994765 -15 ***** **** * Masking position 7 Map Score: 12.1637 Number of sites scoring better than the average of aligned sites = 489 Number in coding regions = 142 Number in noncoding regions = 347 Number of orfs with sites within 600 bp upstream = 19 Fraction of orfs with sites within 600 bp upstream = 0.00305172 Motif number 2 ACGACAGAATTAGACGCGGGGCTTGCCTTT 1 27 1 TAGACGCGGG 0.978504 -69 CGTGCGCAGTTCCTGGTGGGCTGGGCTATA 1 66 1 TCCTGGTGGG 0.974836 -30 CCATGTGGGCTCGAAAAGGG 2 1 0 TCGAAAAGGG 0.979184 -90 TGGGTCCGGTTCCATGTGGGCTCGAAAAGG 2 12 0 TCCATGTGGG 0.824644 -79 TTCAACGTAATCGATATGGGTCCGGTTCCA 2 28 0 TCGATATGGG 0.984153 -63 ********** Masking position 1 Map Score: 5.46114 Number of sites scoring better than the average of aligned sites = 316 Number in coding regions = 82 Number in noncoding regions = 234 Number of orfs with sites within 600 bp upstream = 9 Fraction of orfs with sites within 600 bp upstream = 0.00144555 Motif number 3 AAGAAAGGCAAGCCCCGCGTCTAATTCTGT 1 30 0 AGCCCCGCGT 0.985059 -66 GTATAGCCCAGCCCACCAGGAACTGCGCAC 1 67 0 GCCCACCAGG 0.990889 -29 TGCCGCTGCGTATAGCCCAGC 1 85 0 GCCGCTGCGT 0.983499 -11 CCCTTTTCGAGCCCACATGGAACCGGACCC 2 11 1 GCCCACATGG 0.976627 -80 AACCGCCGCGGTTTTCGACAC 2 80 0 ACCGCCGCGG 0.995531 -11 GAACTTGGGCGCACGAGTTTCGACACCA 3 9 1 GCGCACGAGT 0.973558 -23 ********** Masking position 9 Map Score: 5.71133 Number of sites scoring better than the average of aligned sites = 1314 Number in coding regions = 384 Number in noncoding regions = 930 Number of orfs with sites within 600 bp upstream = 26 Fraction of orfs with sites within 600 bp upstream = 0.00417604 Motif number 4 CAACGGCTTCGCGTTCACGACAG 1 4 1 CGGCTTCGCG 0.993407 -92 ATTAGACGCGGGGCTTGCCTTTCTTATGTT 1 35 1 GGGCTTGCCT 0.985242 -61 AGTTCCTGGTGGGCTGGGCTATACGCAGCG 1 73 1 GGGCTGGGCT 0.997462 -23 TCGACACCTAGTGATTCGCTTGCAGTAATT 2 57 0 GTGATTCGCT 0.981798 -34 ********** Masking position 5 Map Score: 3.60394 Number of sites scoring better than the average of aligned sites = 290 Number in coding regions = 80 Number in noncoding regions = 210 Number of orfs with sites within 600 bp upstream = 6 Fraction of orfs with sites within 600 bp upstream = 0.000963701 Motif number 5 ********** No masking Map Score: -2.59896e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -2.59896e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -2.59896e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0