AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i183_tpal_bbur_100.orf -o183_tpal_bbur_100.ace -a/home/amcguire/genomes/ORF_tpal.txt -z/home/amcguire/genomes/synecho.fna -g0.40 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.4 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RTP00433 150 AE000520 Motif number 1 GGACGATACTTCCAGGTGGCTGTGCAATTG 1 34 1 TCCAGGTGGC 0.972771 -117 TGCAATTGTATCCAGATGGTGCAGGTCGTA 1 56 1 TCCAGATGGT 0.967103 -95 GGTCGTAAGACACCGGTGGTGCATGCAGTA 1 79 1 CACCGGTGGT 0.996348 -72 CAAAAAGACGCCCCGGGGGCAAAGGACGCT 1 131 0 CCCCGGGGGC 0.975393 -20 ********** Masking position 5 Map Score: 7.37294 Number of sites scoring better than the average of aligned sites = 544 Number in coding regions = 162 Number in noncoding regions = 382 Number of orfs with sites within 600 bp upstream = 15 Fraction of orfs with sites within 600 bp upstream = 0.00240925 Motif number 2 TCCAATCCGCTGAGCGGCTGGC 1 1 0 TGGCGGCTGC 0.993602 -150 GTATCCAGATGGTGCAGGTCGTAAGACACCGG 1 63 1 GGGCAGGTGT 0.995725 -88 AGACACCGGTGGTGCATGCAGTAACCGTTGAT 1 86 1 GGGCATGCGT 0.982376 -65 ATGAGCAAGATGAGCGTCCTTTGCCCCCGGGG 1 119 1 TGGCGTCCTT 0.993499 -32 CTTTGCCCCCGGGGCGTCTTTTTG 1 137 1 GGGCGTCTTT 0.996877 -14 ** ****** ** Masking position 5 Map Score: 4.84623 Number of sites scoring better than the average of aligned sites = 362 Number in coding regions = 107 Number in noncoding regions = 255 Number of orfs with sites within 600 bp upstream = 8 Fraction of orfs with sites within 600 bp upstream = 0.00128493 Motif number 3 ********** No masking Map Score: -1.32571e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -1.32571e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.32571e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0