AlignACE version 2.2 July 7, 1998 alignACE -a/home/amcguire/genomes/ORF_aquae.txt -z/home/amcguire/genomes/aquae.fna -iada_aquae_opreg_100.orf -g0.435 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.435 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 petA 125 Rieske-I iron sulfur protein Motif number 1 CAAGTTTATTTTAACTTCCTAACC 1 2 1 ATTTATTTAA 0.987022 -124 TAACTTCCTAACCTTTAATTAACTTTATGTATA 1 22 1 ATTTAATAAC 0.991707 -104 AATTAACTTTATGTATATATAACGAAATTTTTA 1 38 1 ATATATTAAC 0.991707 -88 ATATATAACGAAATTTTTATAAAAATTTTCACC 1 52 1 ATTTTTTAAA 0.972227 -74 AAGTAAACCAAACTATATTTTACTACTCGGCGG 1 83 0 ATATATTTAC 0.984638 -43 CCACCTCCTGAAATTTAAGTAAACCAAACTATA 1 99 0 ATTTAATAAA 0.987022 -27 * ***** **** Masking position 6 Map Score: 8.46263 Number of sites scoring better than the average of aligned sites = 44 Number in coding regions = 33 Number in noncoding regions = 11 Number of orfs with sites within 600 bp upstream = 11 Fraction of orfs with sites within 600 bp upstream = 0.00176678 Motif number 2 CAAGTTTATTTTAACTTCCTAACCTTTAA 1 10 1 TTTAACTTCC 0.986577 -116 TTATAAAAATTTTCACCGCCGAGTAGTAAA 1 68 1 TTTCACCGCC 0.997829 -58 AATACCACCTCCTGAAATTTAA 1 114 0 TACCACCTCC 0.996178 -12 ********** Masking position 5 Map Score: 2.08919 Number of sites scoring better than the average of aligned sites = 96 Number in coding regions = 65 Number in noncoding regions = 31 Number of orfs with sites within 600 bp upstream = 38 Fraction of orfs with sites within 600 bp upstream = 0.00610344 Motif number 3 ********** No masking Map Score: 1.09013e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: 1.09013e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 1.09013e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0