AlignACE version 2.2 July 7, 1998 alignACE -a/home/amcguire/genomes/ORF_aquae.txt -z/home/amcguire/genomes/aquae.fna -imetJ_aquae_opreg_100.orf -g0.435 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.435 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 metF 80 5,10-methylenetetrahydrofolate reductase #2 metE 44 tetrahydropteroyltriglutamate methyltransferase Motif number 1 CACACCTCCCTTGAAAGTTTTTTACACTTTTT 1 13 1 TTAAATTTTT 0.990927 -68 ATTTTATTTCTTAAAAATTCTTAGTCCACCTT 1 45 1 TTAAATTCTT 0.998249 -36 TTAGTCCACCTTTAAAATACTTCCTT 1 65 1 TTAAATACTT 0.994514 -16 ACTTCTTATTTTAAAATATCTTTT 2 3 0 TTAAAATCTT 0.994438 -42 TCTCCTCCTTTTAGAACTTCTTATTTTAAAAT 2 18 0 TTGAATTCTT 0.996287 -27 ** *** ***** Masking position 6 Map Score: 11.525 Number of sites scoring better than the average of aligned sites = 98 Number in coding regions = 89 Number in noncoding regions = 9 Number of orfs with sites within 600 bp upstream = 12 Fraction of orfs with sites within 600 bp upstream = 0.0019274 Motif number 2 TAAAAAACTTTCAAGGGAGGTGTGCC 1 6 0 TAAGGGAGGT 0.989177 -75 AGAAATAAAATAAAAAGTGTAAAAAACTTTC 1 25 0 TAAAAGTGTA 0.975193 -56 AGGAAGTATTTTAAAGGTGGACTAAGAATTT 1 59 0 TAAAGGTGGA 0.997812 -22 AAAAGATATTTTAAAATAAGAAGTTCTAAAA 2 11 1 TAAAATAAGA 0.915784 -34 TAAGAAGTTCTAAAAGGAGGAGAAATCC 2 27 1 TAAAGGAGGA 0.998493 -18 * ********* Masking position 4 Map Score: 6.67262 Number of sites scoring better than the average of aligned sites = 550 Number in coding regions = 483 Number in noncoding regions = 67 Number of orfs with sites within 600 bp upstream = 78 Fraction of orfs with sites within 600 bp upstream = 0.0125281 Motif number 3 CCTTGAAAGTTTTTTACACTTTTTATTTTAT 1 21 1 TTTTACACTT 0.983024 -60 TTAAAAATTCTTAGTCCACCTTTAAAATACT 1 55 1 TTATCCACCT 0.995069 -26 TAGTCCACCTTTAAAATACTTCCTT 1 66 1 TTAAATACTT 0.91733 -15 TCTCCTCCTTTTAGAACTTCTTATTTTAAAA 2 19 0 TTAAACTTCT 0.945794 -26 GGATTTCTCCTCCTTTTAGAACTT 2 31 0 TTTTCCTCCT 0.989929 -14 *** ******* Masking position 2 Map Score: 3.00303 Number of sites scoring better than the average of aligned sites = 743 Number in coding regions = 667 Number in noncoding regions = 76 Number of orfs with sites within 600 bp upstream = 87 Fraction of orfs with sites within 600 bp upstream = 0.0139737 Motif number 4 ********** No masking Map Score: 1.3033e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 1.3033e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 1.3033e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0