AlignACE version 2.2 July 7, 1998 alignACE -a/home/amcguire/genomes/ORF_aquae.txt -z/home/amcguire/genomes/aquae.fna -imetJ_aquae_opreg_300.orf -g0.435 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.435 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 metF 80 5,10-methylenetetrahydrofolate reductase #2 metE 44 tetrahydropteroyltriglutamate methyltransferase Motif number 1 AAAAAGTGTAAAAAACTTTCAAGGGAGGTGTG 1 13 0 AAAAATTTAA 0.99157 -68 AAGGTGGACTAAGAATTTTTAAGAAATAAAAT 1 45 0 AAGAATTTAA 0.998374 -36 AAGGAAGTATTTTAAAGGTGGACTAA 1 65 0 AAGTATTTAA 0.994944 -16 AAAAGATATTTTAAAATAAGAAGT 2 3 1 AAGATTTTAA 0.994861 -42 ATTTTAAAATAAGAAGTTCTAAAAGGAGGAGA 2 18 1 AAGAATTCAA 0.996578 -27 ***** *** ** Masking position 7 Map Score: 11.525 Number of sites scoring better than the average of aligned sites = 98 Number in coding regions = 89 Number in noncoding regions = 9 Number of orfs with sites within 600 bp upstream = 12 Fraction of orfs with sites within 600 bp upstream = 0.0019274 Motif number 2 GGCACACCTCCCTTGAAAGTTTTTTA 1 6 1 ACCTCCCTTA 0.990089 -75 GAAAGTTTTTTACACTTTTTATTTTATTTCT 1 25 1 TACACTTTTA 0.977223 -56 AAATTCTTAGTCCACCTTTAAAATACTTCCT 1 59 1 TCCACCTTTA 0.99799 -22 TTTTAGAACTTCTTATTTTAAAATATCTTTT 2 11 0 TCTTATTTTA 0.922391 -34 GGATTTCTCCTCCTTTTAGAACTTCTTA 2 27 0 TCCTCCTTTA 0.998619 -18 ********* * Masking position 8 Map Score: 6.67262 Number of sites scoring better than the average of aligned sites = 550 Number in coding regions = 483 Number in noncoding regions = 67 Number of orfs with sites within 600 bp upstream = 78 Fraction of orfs with sites within 600 bp upstream = 0.0125281 Motif number 3 ATAAAATAAAAAGTGTAAAAAACTTTCAAGG 1 21 0 AAGTGTAAAA 0.983766 -60 AGTATTTTAAAGGTGGACTAAGAATTTTTAA 1 55 0 AGGTGGATAA 0.995287 -26 AAGGAAGTATTTTAAAGGTGGACTA 1 66 0 AAGTATTTAA 0.92071 -15 TTTTAAAATAAGAAGTTCTAAAAGGAGGAGA 2 19 1 AGAAGTTTAA 0.948076 -26 AAGTTCTAAAAGGAGGAGAAATCC 2 31 1 AGGAGGAAAA 0.990372 -14 ******* *** Masking position 10 Map Score: 3.00303 Number of sites scoring better than the average of aligned sites = 743 Number in coding regions = 667 Number in noncoding regions = 76 Number of orfs with sites within 600 bp upstream = 87 Fraction of orfs with sites within 600 bp upstream = 0.0139737 Motif number 4 ********** No masking Map Score: 1.3033e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 1.3033e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 1.3033e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0