AlignACE version 2.2 July 7, 1998 alignACE -aORF_aful.txt -zaful.fna -icytR_aful_opreg_100.orf -g0.49 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.49 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 AF0913 144 A. fulgidus predicted coding region AF0913 #2 AF1342 126 thymidine phosphorylase (deoA-2) #3 AF1753 39 lysophospholipase #4 AF1755 115 conserved hypothetical protein Motif number 1 AACCGAAAATTTAAAATTTTGCATATACCC 1 40 0 TTAAAATTTT 0.976172 -105 TACGAGGGGTTAAAAACCTTTGACGTCATC 1 114 0 TAAAAACCTT 0.934148 -31 GTCGTCAGCTTTAAAACCTTTTCAGGTGAG 2 22 1 TTAAAACCTT 0.957908 -105 TGTTTATGTTTAAAAATTCTCACCTGAAAA 2 40 0 TAAAAATTCT 0.975902 -87 CGAGAAAAAGTTAATATTCTTTCAGAGTTT 2 97 1 TTAATATTCT 0.920933 -30 TGAACTTCAAAAACTCTGAAAGAATAT 2 110 0 CAAAAACTCT 0.91345 -17 AGAAAAAAGATTAAAATTTTTCGCAG 3 7 0 TTAAAATTTT 0.976172 -33 CTGATTTCCTTTGAAATTCTATCCAGCTCA 4 60 1 TTGAAATTCT 0.945275 -56 ********** Masking position 6 Map Score: 9.72417 Number of sites scoring better than the average of aligned sites = 207 Number in coding regions = 101 Number in noncoding regions = 106 Number of orfs with sites within 600 bp upstream = 121 Fraction of orfs with sites within 600 bp upstream = 0.0194346 Motif number 2 ACTTCTTAAAAAGGAGGTTAAGCGGGAAG 1 8 0 AAGGAGTTAG 0.99051 -137 TTGCATAGGCAATGCGGTTTAGCTTTGATGAC 1 88 1 AATGCGTTAG 0.990516 -57 TTTAGCTTTGATGACGTCAAAGGTTTTTAACC 1 105 1 ATGACGCAAG 0.885516 -40 CGCTATCGTGAAGAAGTTATAGATAATGTTGT 2 67 0 AAGAAGTAAG 0.925341 -60 TTTCTGTCAGAATGAGCTTCAGAATTCCACCT 4 18 1 AATGAGTTAG 0.988275 -98 TCCACCTGAAATTGCGTCTGATTTCCTTTGAA 4 43 1 ATTGCGCTAT 0.875013 -73 AAAGCCTTATTGAGTTTGAGAGGTAAACAC 4 96 0 ATTGAGTTAG 0.985157 -20 ****** ** ** Masking position 11 Map Score: 4.94484 Number of sites scoring better than the average of aligned sites = 572 Number in coding regions = 537 Number in noncoding regions = 35 Number of orfs with sites within 600 bp upstream = 34 Fraction of orfs with sites within 600 bp upstream = 0.00546097 Motif number 3 ATACCCACTTCTTAAAAAGGAGGTTAAGCG 1 16 0 CTTAAAAAGG 0.934242 -129 AAAATTCTCACCTGAAAAGGTTTTAAAGCT 2 28 0 CCTGAAAAGG 0.987397 -99 TTCTCGCTATCGTGAAGAAGTTATAGATAA 2 73 0 CGTGAAGAAG 0.958179 -54 TTCACGATAGCGAGAAAAAGTTAATATTCT 2 87 1 CGAGAAAAAG 0.957692 -40 CTGGTCTTGGCAGAAAAAAGATTAAAATTT 3 18 0 CAGAAAAAAG 0.950802 -22 CTCATTCTGACAGAAAAATGAAA 4 4 0 CAGAAAAATG 0.930973 -112 CAGAATTCCACCTGAAATTGCGTCTGATTT 4 37 1 CCTGAAATTG 0.915131 -79 ********** Masking position 5 Map Score: 3.43355 Number of sites scoring better than the average of aligned sites = 788 Number in coding regions = 711 Number in noncoding regions = 77 Number of orfs with sites within 600 bp upstream = 45 Fraction of orfs with sites within 600 bp upstream = 0.00722775 Motif number 4 AGCAGGGAATGATGATGTAACCGAAAATTT 1 58 0 GATGATGTAA 0.965785 -87 GTTTAGCTTTGATGACGTCAAAGGTTTTTA 1 104 1 GATGACGTCA 0.995261 -41 AGGTTTTAAAGCTGACGACAATTTAACATC 2 11 0 GCTGACGACA 0.990108 -116 ********** Masking position 5 Map Score: 0.315522 Number of sites scoring better than the average of aligned sites = 44 Number in coding regions = 42 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 4 Fraction of orfs with sites within 600 bp upstream = 0.000642467 Motif number 5 CCCTGCTTTGCATAGGCAATGCGGTTTAGC 1 81 1 CATAGGCAAT 0.989229 -64 CAAAGGAAATCAGACGCAATTTCAGGTGGA 4 43 0 CAGACGCAAT 0.992707 -73 GATAGAATTTCAAAGGAAATCAGACGCAAT 4 53 0 CAAAGGAAAT 0.976056 -63 GTTTACCTCTCAAACTCAATAAGGCTTT 4 98 1 CAAACTCAAT 0.976056 -18 ********** Masking position 4 Map Score: 2.78576 Number of sites scoring better than the average of aligned sites = 46 Number in coding regions = 43 Number in noncoding regions = 3 Number of orfs with sites within 600 bp upstream = 4 Fraction of orfs with sites within 600 bp upstream = 0.000642467 Motif number 6 ********** No masking Map Score: -3.17312e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -3.17312e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -3.17312e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0