AlignACE version 2.2 July 7, 1998 alignACE -aORF_aful.txt -zaful.fna -idnaA_aful_opreg_100.orf -g0.49 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.49 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 AF1664 147 ribonucleotide reductase (nrd) Motif number 1 ACAGCATCTCAAGAAAACTTGACATTAACT 1 39 0 AAGAAAACTT 0.989567 -109 GAGATGCTGTAAGAAAAATTTTTCTATTCA 1 59 1 AAGAAAAATT 0.996136 -89 CATCTATTGAAGGAAAAATTGAATAGAAAA 1 78 0 AGGAAAAATT 0.996485 -70 CTCGAAGGGCAGGCAAAATTGTTTTATCTT 1 110 1 AGGCAAAATT 0.992213 -38 TATGGTAGATAAGAAAGATAAAACAATTTT 1 124 0 AAGAAAGATA 0.972951 -24 ********** Masking position 5 Map Score: 10.9974 Number of sites scoring better than the average of aligned sites = 45 Number in coding regions = 29 Number in noncoding regions = 16 Number of orfs with sites within 600 bp upstream = 16 Fraction of orfs with sites within 600 bp upstream = 0.00256987 Motif number 2 TGTCCTGTCTTCTTGAAAAGTATTAAAGTT 1 13 1 TCTTGAAAAG 0.991674 -135 TGTCAAGTTTTCTTGAGATGCTGTAAGAAA 1 45 1 TCTTGAGATG 0.968335 -103 TTGAAGGAAAAATTGAATAGAAAAATTTTT 1 72 0 AATTGAATAG 0.904721 -76 CGAGAGCATCTATTGAAGGAAAAATTGAAT 1 84 0 TATTGAAGGA 0.960303 -64 CAATAGATGCTCTCGAAGGGCAGGCAAAAT 1 99 1 TCTCGAAGGG 0.992433 -49 ********** Masking position 6 Map Score: 2.36786 Number of sites scoring better than the average of aligned sites = 784 Number in coding regions = 747 Number in noncoding regions = 37 Number of orfs with sites within 600 bp upstream = 37 Fraction of orfs with sites within 600 bp upstream = 0.00594282 Motif number 3 ********** No masking Map Score: 5.92755e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: 5.92755e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 5.92755e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0