AlignACE version 2.2 July 7, 1998 alignACE -aORF_aful.txt -zaful.fna -idnaA_aful_opreg_300.orf -g0.49 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.49 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 AF1664 147 ribonucleotide reductase (nrd) Motif number 1 ACAGCATCTCAAGAAAACTTGACATTAACT 1 39 0 AAGAAAACTT 0.989827 -109 GAGATGCTGTAAGAAAAATTTTTCTATTCA 1 59 1 AAGAAAAATT 0.996292 -89 CATCTATTGAAGGAAAAATTGAATAGAAAA 1 78 0 AGGAAAAATT 0.996633 -70 CTCGAAGGGCAGGCAAAATTGTTTTATCTT 1 110 1 AGGCAAAATT 0.992538 -38 TATGGTAGATAAGAAAGATAAAACAATTTT 1 124 0 AAGAAAGATA 0.974065 -24 ********** Masking position 5 Map Score: 10.9974 Number of sites scoring better than the average of aligned sites = 45 Number in coding regions = 29 Number in noncoding regions = 16 Number of orfs with sites within 600 bp upstream = 16 Fraction of orfs with sites within 600 bp upstream = 0.00256987 Motif number 2 TAACTTTAATACTTTTCAAGAAGACAGGAC 1 14 0 ACTTTTCAAG 0.985461 -134 TTTTCTTACAGCATCTCAAGAAAACTTGAC 1 46 0 GCATCTCAAG 0.961997 -102 GAAAAATTTTTCTATTCAATTTTTCCTTCA 1 71 1 TCTATTCAAT 0.958164 -77 TTCGAGAGCATCTATTGAAGGAAAAATTGA 1 86 0 TCTATTGAAG 0.987959 -62 TTCAATAGATGCTCTCGAAGGGCAGGCAAA 1 97 1 GCTCTCGAAG 0.979611 -51 ********** Masking position 8 Map Score: 2.36786 Number of sites scoring better than the average of aligned sites = 758 Number in coding regions = 716 Number in noncoding regions = 42 Number of orfs with sites within 600 bp upstream = 35 Fraction of orfs with sites within 600 bp upstream = 0.00562159 Motif number 3 TTTTCAAGAAGACAGGACATC 1 2 0 GACAGGACAT 0.97985 -146 AAGAAAACTTGACATTAACTTTAATACTTT 1 29 0 GACATTAACT 0.95678 -119 AAATTTTTCTTACAGCATCTCAAGAAAACT 1 50 0 TACAGCATCT 0.990695 -98 CCTGCCCTTCGAGAGCATCTATTGAAGGAA 1 93 0 GAGAGCATCT 0.993701 -55 ********** Masking position 4 Map Score: 0.892565 Number of sites scoring better than the average of aligned sites = 394 Number in coding regions = 362 Number in noncoding regions = 32 Number of orfs with sites within 600 bp upstream = 30 Fraction of orfs with sites within 600 bp upstream = 0.0048185 Motif number 4 ********** No masking Map Score: 5.92755e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 5.92755e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 5.92755e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0