AlignACE version 2.2 July 7, 1998 alignACE -aORF_aful.txt -zaful.fna -ilacI_aful_opreg_100.orf -g0.49 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.49 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 AF1055 111 flagellin (flaB1-2) Motif number 1 TTTCTAAGTTGAAATTTCCTTTACGTAATT 1 11 0 GAAATTTCCT 0.998156 -101 CTTATATGTTGAAATTACCTTTTTCTAAGT 1 32 0 GAAATTACCT 0.996758 -80 CAATATATAAGAATTTTCTTATATGTTGAA 1 49 0 GAATTTTCTT 0.991184 -63 ********** Masking position 3 Map Score: 5.30107 Number of sites scoring better than the average of aligned sites = 38 Number in coding regions = 34 Number in noncoding regions = 4 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 2 AATTACCTTTTTCTAAGTTGAAATTTCCTT 1 20 0 TTCTAAGTTG 0.993596 -92 AAGAATTTTCTTATATGTTGAAATTACCTT 1 41 0 TTATATGTTG 0.996394 -71 AAGAAAATTCTTATATATTGCTAATCGCTG 1 59 1 TTATATATTG 0.985968 -53 ********** Masking position 5 Map Score: 4.47139 Number of sites scoring better than the average of aligned sites = 10 Number in coding regions = 5 Number in noncoding regions = 5 Number of orfs with sites within 600 bp upstream = 5 Fraction of orfs with sites within 600 bp upstream = 0.000803084 Motif number 3 CTAAGTTGAAATTTCCTTTACGTAATT 1 8 0 ATTTCCTTTA 0.987966 -104 ATATGTTGAAATTACCTTTTTCTAAGTTGA 1 29 0 ATTACCTTTT 0.993043 -83 ATATATAAGAATTTTCTTATATGTTGAAAT 1 47 0 ATTTTCTTAT 0.935065 -65 CCCATCACCTCTCACCTCATCCT 1 99 0 ATCACCTCTC 0.976666 -13 ********** Masking position 7 Map Score: 2.03645 Number of sites scoring better than the average of aligned sites = 313 Number in coding regions = 279 Number in noncoding regions = 34 Number of orfs with sites within 600 bp upstream = 28 Fraction of orfs with sites within 600 bp upstream = 0.00449727 Motif number 4 ********** No masking Map Score: -1.17788e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.17788e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -1.17788e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0