AlignACE version 2.2 July 7, 1998 alignACE -aORF_aful.txt -zaful.fna -imelR_aful_opreg_100.orf -g0.49 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.49 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 AF0616 23 conserved hypothetical protein #2 AF0617 106 LPS biosynthesis protein, putative Motif number 1 TAGCTAATATATCAAGCAAATTT 1 6 1 AATATATCAA 0.989838 -18 TTAATCTACAAGAACATCAAATTCGCTTAT 2 18 0 AGAACATCAA 0.972755 -89 TTTCAGCAAAAAGATATTAATCTACAAGAA 2 34 0 AAGATATTAA 0.988754 -73 TTTTTGCTGAAAAATATCAATATCCACCAC 2 52 1 AAAATATCAA 0.992256 -55 CCTTTAATTTCAGATATTAAACTTTGTTGT 2 80 0 CAGATATTAA 0.978993 -27 ********** Masking position 6 Map Score: 8.31819 Number of sites scoring better than the average of aligned sites = 34 Number in coding regions = 22 Number in noncoding regions = 12 Number of orfs with sites within 600 bp upstream = 13 Fraction of orfs with sites within 600 bp upstream = 0.00208802 Motif number 2 TAGCTAATATATCAAGCAAA 1 1 1 TAGCTAATAT 0.98269 -23 CTAATATATCAAGCAAATTT 1 14 1 AAGCAAATTT 0.99387 -10 GGAGGTCATAAGCGAATTTGATGTTCTTG 2 10 1 AAGCGAATTT 0.99569 -97 ********** Masking position 6 Map Score: 3.19096 Number of sites scoring better than the average of aligned sites = 22 Number in coding regions = 16 Number in noncoding regions = 6 Number of orfs with sites within 600 bp upstream = 7 Fraction of orfs with sites within 600 bp upstream = 0.00112432 Motif number 3 AAATTTGCTTGATATATTAGCTA 1 8 0 ATTCGATATA 0.894444 -16 GAATTTGATGTTCTTGTAGATTAATATCTTTTTG 2 24 1 TTTGGATTAA 0.955334 -83 GATTAATATCTTTTTGCTGAAAAATATCAATATC 2 42 1 TTTGGAAAAA 0.632129 -65 TTAAACTTTGTTGTGGTGGATATTGATATTTTTC 2 60 0 TTTGGATATT 0.988958 -47 ATATCTGAAATTAAAGGGGAAAAT 2 93 1 TTAGGAAAAT 0.954892 -14 ** * * ****** Masking position 10 Map Score: 0.140387 Number of sites scoring better than the average of aligned sites = 202 Number in coding regions = 169 Number in noncoding regions = 33 Number of orfs with sites within 600 bp upstream = 33 Fraction of orfs with sites within 600 bp upstream = 0.00530035 Motif number 4 ********** No masking Map Score: -7.57276e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -7.57276e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -7.57276e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0