AlignACE version 2.2 July 7, 1998 alignACE -aORF_aful.txt -zaful.fna -iphoB_aful_opreg_100.orf -g0.49 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.49 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 AF0433 122 conserved hypothetical protein #2 AF0477 140 AAA superfamily ATPase #3 AF0521 39 protease synthase and sporulation regulator Pai1, putative #4 AF1356 96 phosphate ABC transporter, periplasmic phosphate-binding protein (phoX) #5 AF1608 59 spermidine/putrescine ABC transporter, ATP-binding protein (potA) Motif number 1 AATTTTTCTTCTCATAAATTTACTGTTCTTTG 1 20 1 CTATAATTTA 0.922243 -103 ACACCAAAAACCAAAATTTTAATCTTCAGTCT 1 64 1 CCAAATTTAA 0.947884 -59 CAAGCTGATTCAGAAAACTTTATCAAATCCGA 2 25 0 CAAAAATTTA 0.981743 -116 TCTGAATCAGCTTGTAACTTTAAACCTAAAAC 2 43 1 CTGTAATTTA 0.852906 -98 TAACTTTAAACCTAAAACTTAACCAAAAACGA 2 57 1 CCAAAATTAA 0.972304 -84 GGCAGAACTCCCAAAAAATTTAAATCACGATT 2 94 1 CCAAAATTTA 0.991033 -47 AGGGAAAACGCATAAATATTTAGATTTTCACG 4 18 0 CAAAATTTTA 0.965551 -79 TTCGTGTCAGCCCAATTTTTTATCTA 5 5 0 CCAATTTTTA 0.901779 -55 ATTGGGCTGACACGAAAGTTTTTTATACAAAA 5 21 1 CAGAAATTTT 0.805626 -39 ** **** **** Masking position 9 Map Score: 9.16786 Number of sites scoring better than the average of aligned sites = 189 Number in coding regions = 94 Number in noncoding regions = 95 Number of orfs with sites within 600 bp upstream = 120 Fraction of orfs with sites within 600 bp upstream = 0.019274 Motif number 2 TTACCAAAGGTTACAAAGAACAGTAAATTTA 1 34 0 TTACAAGAAC 0.826871 -89 ACCTTTGGTAACACCAAAAACCAAAATTTTA 1 54 1 ACACCAAAAC 0.981748 -69 TTGTGTGGTGTTACTAACAACTGTGCTAATG 1 98 0 TTACTACAAC 0.776736 -25 GTTAGTAACACCACACAAAAAG 1 111 1 CCACAAAAAA 0.861822 -12 GATTTTCCTAAAAATCGGATTTGA 2 4 1 TTTCCAAAAA 0.940873 -137 TTACAAGCTGATTCAGAAAACTTTATCAAAT 2 29 0 ATTCAAAAAC 0.924724 -112 TTGTAACTTTAAACCTAAAACTTAACCAAAA 2 54 1 AAACCAAAAC 0.959796 -87 ACCTAAAACTTAACCAAAAACGAAGTCAGGC 2 66 1 TAACCAAAAC 0.959796 -75 GTCAGGCAGAACTCCCAAAAAATTTAAATCA 2 90 1 ACTCCAAAAA 0.940044 -51 CTGGGACACTTCCTACAAATCACCGAATC 2 122 0 CTTCCACAAA 0.866331 -19 ***** ***** Masking position 7 Map Score: 6.64505 Number of sites scoring better than the average of aligned sites = 735 Number in coding regions = 632 Number in noncoding regions = 103 Number of orfs with sites within 600 bp upstream = 102 Fraction of orfs with sites within 600 bp upstream = 0.0163829 Motif number 3 TAGTTAGTAAATGTTGTATATACCATCCCT 4 51 0 ATGTTGTATA 0.992519 -46 TACTAACTATATGATGTATATTTTAATGCG 4 72 1 ATGATGTATA 0.986883 -25 CAATCAATCCATTTTGTATAAAAAACTTTC 5 34 0 ATTTTGTATA 0.979855 -26 ********** Masking position 8 Map Score: 2.10308 Number of sites scoring better than the average of aligned sites = 7 Number in coding regions = 2 Number in noncoding regions = 5 Number of orfs with sites within 600 bp upstream = 6 Fraction of orfs with sites within 600 bp upstream = 0.000963701 Motif number 4 AAGGTTACAAAGAACAGTAAATTTATGAGA 1 29 0 AGAACAGTAA 0.92066 -94 GTCTGCCATTAGCACAGTTGTTAGTAACAC 1 92 1 AGCACAGTTG 0.985577 -31 AGCTCTTAAAAGCCCAGTATATAAGCCTGA 3 17 1 AGCCCAGTAT 0.992066 -23 CTTTCGTGTCAGCCCAATTTTTTATCTA 5 9 0 AGCCCAATTT 0.96937 -51 ********** Masking position 6 Map Score: 0.503865 Number of sites scoring better than the average of aligned sites = 48 Number in coding regions = 37 Number in noncoding regions = 11 Number of orfs with sites within 600 bp upstream = 11 Fraction of orfs with sites within 600 bp upstream = 0.00176678 Motif number 5 ********** No masking Map Score: -5.51791e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -5.51791e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -5.51791e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0