AlignACE version 2.2 July 7, 1998 alignACE -aORF_aful.txt -zaful.fna -itorR_aful_opreg_300.orf -g0.49 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.49 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 AF1237 191 A. fulgidus predicted coding region AF1237 Motif number 1 ATTTTTCCGGTTTTAAATTTTGCTATCCTTT 1 25 1 TTTTAAATTT 0.953327 -167 GCGGAAAGTTTTATCACTGTTAACTCCTGAG 1 65 1 TTATCACGTT 0.996427 -127 AACTCCTGAGTTATCACTGTTAACAAAATGT 1 86 1 TTATCACGTT 0.996427 -106 TGATGTGATTTTTTAAAGGTTTTGACAAATG 1 116 1 TTTTAAAGTT 0.983726 -76 TCTACGATTTTTATCGCATTTGTCAAAACCT 1 132 0 TTATCGCTTT 0.971795 -60 AATTTCCAATTTATAAAAGTTACTTCTACGA 1 156 0 TTATAAAGTT 0.991212 -36 ******* *** Masking position 4 Map Score: 10.1118 Number of sites scoring better than the average of aligned sites = 80 Number in coding regions = 64 Number in noncoding regions = 16 Number of orfs with sites within 600 bp upstream = 18 Fraction of orfs with sites within 600 bp upstream = 0.0028911 Motif number 2 TAACTCAGGAGTTAACAGTGATAAAACTTT 1 69 0 GTTAACAGTG 0.998405 -123 ATCACATTTTGTTAACAGTGATAACTCAGG 1 90 0 GTTAACAGTG 0.998405 -102 ********** Masking position 5 Map Score: 2.92344 Number of sites scoring better than the average of aligned sites = 2 Number in coding regions = 0 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 3 GCAAAATTTAAAACCGGAAAAATAAAGGGGCAAGG 1 13 0 AAAGGAATAA 0.997415 -179 CGCCTGTTACTAAAAGGATAGCAAAATTTAAAACC 1 33 0 TAAGGAAAAA 0.983741 -159 AATGCGATAAAAATCGTAGAAGTAACTTTTATAAA 1 143 1 AAAGTAATAA 0.989819 -49 TAACTTTTATAAATTGGAAATTTAATAGGTAAGGC 1 165 1 AAAGGAATAA 0.997415 -27 *** *** * *** Masking position 8 Map Score: 2.20052 Number of sites scoring better than the average of aligned sites = 11 Number in coding regions = 7 Number in noncoding regions = 4 Number of orfs with sites within 600 bp upstream = 4 Fraction of orfs with sites within 600 bp upstream = 0.000642467 Motif number 4 ********** No masking Map Score: 1.65857e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 1.65857e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 1.65857e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0