AlignACE version 2.2 July 7, 1998 alignACE -a/home/amcguire/genomes/ORF_borburg.txt -z/home/amcguire/genomes/borburg.fna -icspA_bbur_opreg_100.orf -g0.282 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.282 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 BB0436 172 DNA gyrase, subunit B (gyrB) Motif number 1 ATGTTAAAAGTATAGTGCTAAAACCAACAAG 1 20 0 TAAGTGCTAA 0.980955 -153 CATTATACTATATAATGTTAAAAGTATAGTG 1 34 0 TAAATGTTAA 0.993976 -139 CATTATATAGTATAATGTTAAATTAGGATTC 1 48 1 TAAATGTTAA 0.993976 -125 ACAATTTAGATAGAATCCTAATTTAACATTA 1 60 0 TAAATCCTAA 0.986675 -113 TTATTTTTTTTTTAATGTAGAATTTATCTGT 1 135 1 TTAATGTAGA 0.948692 -38 TTAATTAAAATCTAGACACAGATAAA 1 157 0 TAAATCTAGA 0.974867 -16 ** ******** Masking position 6 Map Score: 8.21255 Number of sites scoring better than the average of aligned sites = 112 Number in coding regions = 69 Number in noncoding regions = 43 Number of orfs with sites within 600 bp upstream = 22 Fraction of orfs with sites within 600 bp upstream = 0.00353357 Motif number 2 TTTTAGCACTATACTTTTAACATTATATAG 1 28 1 ATACTTTTAA 0.935953 -145 ATTTAACATTATACTATATAATGTTAAAAG 1 41 0 ATACTATATA 0.947543 -132 AAAAATTCACAAACAATTTAGATAGAATCC 1 73 0 AAACAATTTA 0.935953 -100 GAAATACCAAAAACTTTTAAAAATTCACAA 1 91 0 AAACTTTTAA 0.863702 -82 TAAAAAAAAAATAATATCTATTACATAGGA 1 119 0 ATAATATCTA 0.970546 -54 CTAGACACAGATAAATTCTACATTAAAAAA 1 142 0 ATAAATTCTA 0.952655 -31 TTAATTAAAATCTAGACACAGATA 1 159 0 TTAAAATCTA 0.824669 -14 ********** Masking position 3 Map Score: 5.33373 Number of sites scoring better than the average of aligned sites = 779 Number in coding regions = 488 Number in noncoding regions = 291 Number of orfs with sites within 600 bp upstream = 70 Fraction of orfs with sites within 600 bp upstream = 0.0112432 Motif number 3 AAAACCAACAAGGACAAAAAA 1 2 0 AGGACAAAAA 0.976557 -171 GTATAGTGCTAAAACCAACAAGGACAAAAA 1 12 0 AAAACCAACA 0.987124 -161 TTACATAGGAAATACCAAAAACTTTTAAAA 1 99 0 AATACCAAAA 0.986687 -74 ATTCTACATTAAAAAAAAAATAATATCTAT 1 128 0 AAAAAAAAAA 0.955089 -45 ********** Masking position 4 Map Score: 1.50682 Number of sites scoring better than the average of aligned sites = 474 Number in coding regions = 327 Number in noncoding regions = 147 Number of orfs with sites within 600 bp upstream = 38 Fraction of orfs with sites within 600 bp upstream = 0.00610344 Motif number 4 ********** No masking Map Score: 1.51646e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 1.51646e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 1.51646e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0