AlignACE version 2.2 July 7, 1998 alignACE -a/home/amcguire/genomes/ORF_borburg.txt -z/home/amcguire/genomes/borburg.fna -icspA_bbur_opreg_300.orf -g0.282 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.282 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 BB0436 172 DNA gyrase, subunit B (gyrB) Motif number 1 CTTGTTGGTTTTAGCACTATACTTTTAACAT 1 20 1 TTAGCACTTA 0.982432 -153 CACTATACTTTTAACATTATATAGTATAATG 1 34 1 TTAACATTTA 0.99442 -139 GAATCCTAATTTAACATTATACTATATAATG 1 48 0 TTAACATTTA 0.99442 -125 TAATGTTAAATTAGGATTCTATCTAAATTGT 1 60 1 TTAGGATTTA 0.987726 -113 ACAGATAAATTCTACATTAAAAAAAAAATAA 1 135 0 TCTACATTAA 0.952493 -38 TTTATCTGTGTCTAGATTTTAATTAA 1 157 1 TCTAGATTTA 0.976736 -16 ******** ** Masking position 6 Map Score: 8.21255 Number of sites scoring better than the average of aligned sites = 112 Number in coding regions = 69 Number in noncoding regions = 43 Number of orfs with sites within 600 bp upstream = 22 Fraction of orfs with sites within 600 bp upstream = 0.00353357 Motif number 2 CTATATAATGTTAAAAGTATAGTGCTAAAA 1 28 0 TTAAAAGTAT 0.944244 -145 CTTTTAACATTATATAGTATAATGTTAAAT 1 41 1 TATATAGTAT 0.955072 -132 GGATTCTATCTAAATTGTTTGTGAATTTTT 1 73 1 TAAATTGTTT 0.944244 -100 TTGTGAATTTTTAAAAGTTTTTGGTATTTC 1 91 1 TTAAAAGTTT 0.880103 -82 TCCTATGTAATAGATATTATTTTTTTTTTA 1 119 1 TAGATATTAT 0.97438 -54 TTTTTTAATGTAGAATTTATCTGTGTCTAG 1 142 1 TAGAATTTAT 0.959215 -31 TATCTGTGTCTAGATTTTAATTAA 1 159 1 TAGATTTTAA 0.840247 -14 ********** Masking position 4 Map Score: 5.33373 Number of sites scoring better than the average of aligned sites = 779 Number in coding regions = 488 Number in noncoding regions = 291 Number of orfs with sites within 600 bp upstream = 70 Fraction of orfs with sites within 600 bp upstream = 0.0112432 Motif number 3 AAACCAACAAGGACAAAAAA 1 1 0 GGACAAAAAA 0.961156 -172 TATAGTGCTAAAACCAACAAGGACAAAAAA 1 11 0 AAACCAACAA 0.983189 -162 TTTTAAAAATTCACAAACAATTTAGATAGA 1 77 0 TCACAAACAA 0.970732 -96 TACATAGGAAATACCAAAAACTTTTAAAAA 1 98 0 ATACCAAAAA 0.968478 -75 ATTCTACATTAAAAAAAAAATAATATCTAT 1 128 0 AAAAAAAAAA 0.90999 -45 TAAAATCTAGACACAGATAAATTCTACATT 1 148 0 ACACAGATAA 0.936013 -25 ********** Masking position 7 Map Score: 2.64617 Number of sites scoring better than the average of aligned sites = 793 Number in coding regions = 525 Number in noncoding regions = 268 Number of orfs with sites within 600 bp upstream = 60 Fraction of orfs with sites within 600 bp upstream = 0.00963701 Motif number 4 ********** No masking Map Score: 1.51646e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 1.51646e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 1.51646e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0