AlignACE version 2.2 July 7, 1998 alignACE -a/home/amcguire/genomes/ORF_borburg.txt -z/home/amcguire/genomes/borburg.fna -icytR_bbur_opreg_300.orf -g0.282 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.282 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 BB0618 87 cytidine deaminase (cdd) Motif number 1 GTTTTTAGCTTATTTTACATTGACTAT 1 6 1 TATTATTTTA 0.94336 -82 TTTATTTTATTGAAATATTGTAATATAGTCAA 1 30 0 TGATATTGTA 0.528579 -58 TTAGCCATTGTGGTTTATTTTATTGAAATATT 1 43 0 TGTTATTTTA 0.993925 -45 ATTTCCCACCTGTTATATTTTATTAGCCATTG 1 65 0 TGATATTTTA 0.949762 -23 ** ******** Masking position 6 Map Score: 7.36366 Number of sites scoring better than the average of aligned sites = 64 Number in coding regions = 36 Number in noncoding regions = 28 Number of orfs with sites within 600 bp upstream = 13 Fraction of orfs with sites within 600 bp upstream = 0.00208802 Motif number 2 AGTCAATGTAAAATAAGCTAAAAAC 1 6 0 AAATAAGCTA 0.973868 -82 AGCTTATTTTACATTGACTATATTACAATA 1 17 1 ACATTGACTA 0.994445 -71 AAAATAAACCACAATGGCTAATAAAATATA 1 54 1 ACAATGGCTA 0.996411 -34 ********** Masking position 3 Map Score: 2.13028 Number of sites scoring better than the average of aligned sites = 23 Number in coding regions = 12 Number in noncoding regions = 11 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 3 TAATATAGTCAATGTAAAATAAGCTAAAAA 1 12 0 AATGTAAAAT 0.768537 -76 TTATTGAAATATTGTAATATAGTCAATGTA 1 26 0 ATTGTAATAT 0.843627 -62 ATTGTGGTTTATTTTATTGAAATATTGTAA 1 39 0 ATTTTATTGA 0.946209 -49 CACCTGTTATATTTTATTAGCCATTGTGGT 1 61 0 ATTTTATTAG 0.964385 -27 ********** Masking position 5 Map Score: 0.937279 Number of sites scoring better than the average of aligned sites = 841 Number in coding regions = 506 Number in noncoding regions = 335 Number of orfs with sites within 600 bp upstream = 113 Fraction of orfs with sites within 600 bp upstream = 0.0181497 Motif number 4 ********** No masking Map Score: 5.21701e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 5.21701e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 5.21701e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0