AlignACE version 2.2 July 7, 1998 alignACE -a/home/amcguire/alignace/lib/ORF_bsub.txt -z/skink1/amcguire/genomes/bsub.fna -icspA_bsub_opreg_100.orf -g0.435 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.435 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 gyrA 210 DNA gyrase (subunit A) Motif number 1 TTTCTTATTGGAAATAAGGCTTTTTATGA 1 10 0 GAAATAAGGC 0.981445 -201 TTTCCAATAAGAAATAAGGCTTTTTTCTGA 1 26 1 GAAATAAGGC 0.981445 -185 TAAGTTTATTGATATAATGGAGAATAGTGA 1 120 1 GATATAATGG 0.983275 -91 CGTATTGAAGGTCATAATGGACAATCTACT 1 153 1 GTCATAATGG 0.963401 -58 AGTATCACATGAAATATGTGGGAGTAGATT 1 175 0 GAAATATGTG 0.854779 -36 ********** Masking position 5 Map Score: 6.02849 Number of sites scoring better than the average of aligned sites = 204 Number in coding regions = 161 Number in noncoding regions = 43 Number of orfs with sites within 600 bp upstream = 41 Fraction of orfs with sites within 600 bp upstream = 0.00658529 Motif number 2 TATTGGAAATAAGGCTTTTTATGA 1 5 0 AAGGCTTTTT 0.997382 -206 AATAAGAAATAAGGCTTTTTTCTGAACAAG 1 31 1 AAGGCTTTTT 0.997382 -180 ATACTTCAGGGAGGTTTTTTA 1 200 1 GAGGTTTTTT 0.991863 -11 ********** Masking position 2 Map Score: 5.14474 Number of sites scoring better than the average of aligned sites = 77 Number in coding regions = 54 Number in noncoding regions = 23 Number of orfs with sites within 600 bp upstream = 16 Fraction of orfs with sites within 600 bp upstream = 0.00256987 Motif number 3 TGCAGCGATGCCTGCAATACCTATATATTC 1 67 1 CCTGCAATAC 0.997446 -144 TCCATTATGACCTTCAATACGATTTCACTA 1 144 0 CCTTCAATAC 0.989929 -67 TGAAGTATCACATGAAATATGTGGGAGTAG 1 178 0 CATGAAATAT 0.976238 -33 AAAAAACCTCCCTGAAGTATCACATGAAAT 1 190 0 CCTGAAGTAT 0.989664 -21 ********** Masking position 6 Map Score: 4.57387 Number of sites scoring better than the average of aligned sites = 117 Number in coding regions = 110 Number in noncoding regions = 7 Number of orfs with sites within 600 bp upstream = 5 Fraction of orfs with sites within 600 bp upstream = 0.000803084 Motif number 4 TTATTGATATAATGGAGAATAGTGAAATCG 1 125 1 AATGGAGAAT 0.991424 -86 TGAAGGTCATAATGGACAATCTACTCCCAC 1 158 1 AATGGACAAT 0.956697 -53 ********** Masking position 6 Map Score: 0.487675 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 3.71914e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 3.71914e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 3.71914e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0