AlignACE version 2.2 July 7, 1998 alignACE -a/home/amcguire/alignace/lib/ORF_bsub.txt -z/skink1/amcguire/genomes/bsub.fna -iilvY_bsub_opreg_300.orf -g0.435 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.435 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 gltC 146 transcriptional regulator (LysR family) Motif number 1 GGTCATAAAATCTAACAACTCTATAATCATTGT 1 45 1 TCTAACTCTA 0.990952 -102 TTGTAGGTTTTCAAAACGATATAAACAATATAT 1 74 1 TCAAAATATA 0.993536 -73 ATTCTTTTGATCTAAATTATATATTGTTTATAT 1 92 0 TCTAAATATA 0.989978 -55 ATAATTTAGATCAAAAGAATCTCAAAATGAGAT 1 105 1 TCAAAATCTC 0.993759 -42 GTTTGTCTCACATCCATCTATCTCATTTTG 1 127 0 TCACAATCTA 0.993759 -20 ***** ***** Masking position 5 Map Score: 5.55769 Number of sites scoring better than the average of aligned sites = 109 Number in coding regions = 95 Number in noncoding regions = 14 Number of orfs with sites within 600 bp upstream = 16 Fraction of orfs with sites within 600 bp upstream = 0.00256987 Motif number 2 AAATCTAACAACTCTATAATCATTGTAGGT 1 52 1 ACTCTATAAT 0.95439 -95 TCGTTTTGAAAACCTACAATGATTATAGAG 1 63 0 AACCTACAAT 0.970365 -84 GGTTTTCAAAACGATATAAACAATATATAA 1 79 1 ACGATATAAA 0.955157 -68 CGATATAAACAATATATAATTTAGATCAAA 1 90 1 AATATATAAT 0.755613 -57 ********** Masking position 5 Map Score: 1.24046 Number of sites scoring better than the average of aligned sites = 94 Number in coding regions = 62 Number in noncoding regions = 32 Number of orfs with sites within 600 bp upstream = 44 Fraction of orfs with sites within 600 bp upstream = 0.00706714 Motif number 3 ********** No masking Map Score: -1.17788e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -1.17788e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.17788e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0