AlignACE version 2.2 July 7, 1998 alignACE -a/home/amcguire/alignace/lib/ORF_bsub.txt -z/skink1/amcguire/genomes/bsub.fna -iompR_bsub_opreg_100.orf -g0.435 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.435 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 yrpD 300 similar to hypothetical proteins from B. subtilis Motif number 1 GGAAAGAGAGAAAACACTGTAATCAGATAT 1 30 0 AAAACACTGT 0.967769 -271 TATTGAAATAGAAAAGCTATAGAGAGGGGG 1 73 0 GAAAAGCTAT 0.986655 -228 AGTCTCGATTGAAAAGTTATCGTAACATTT 1 110 1 GAAAAGTTAT 0.96958 -191 CTTGTATTATAAAACATTATGAAAATAATT 1 240 0 AAAACATTAT 0.95219 -61 TTATAATTAGAAAACGCTATCATCTTGTAT 1 263 0 AAAACGCTAT 0.977382 -38 ********** Masking position 4 Map Score: 5.05993 Number of sites scoring better than the average of aligned sites = 230 Number in coding regions = 203 Number in noncoding regions = 27 Number of orfs with sites within 600 bp upstream = 40 Fraction of orfs with sites within 600 bp upstream = 0.00642467 Motif number 2 GGGAGAAATAAGAGGGGAAAGAGAGAAAAC 1 45 0 AGAGGGGAAA 0.996304 -256 AAAGCTATAGAGAGGGGGGAGAAATAAGAG 1 61 0 AGAGGGGGGA 0.998384 -240 AATTATAATGATAGGGGGAAATAATG 1 285 1 ATAGGGGGAA 0.996303 -16 ********** Masking position 3 Map Score: 4.03889 Number of sites scoring better than the average of aligned sites = 18 Number in coding regions = 8 Number in noncoding regions = 10 Number of orfs with sites within 600 bp upstream = 10 Fraction of orfs with sites within 600 bp upstream = 0.00160617 Motif number 3 GTAATCAGATATGTGTGTATAACTCAATTG 1 12 0 ATGTGTGTAT 0.979379 -289 ATCTCCTGTGAAGTGTAAATGTTACGATAA 1 126 0 AAGTGTAAAT 0.92411 -175 CACATTATGACTTTGTGCATCTGGCAAACG 1 177 0 CTTTGTGCAT 0.974682 -124 CAAAGTCATAATGTGTAAATTCTGTATCTA 1 192 1 ATGTGTAAAT 0.945016 -109 AATTCTGTATCTATGTGCATGTTTATTATG 1 209 1 CTATGTGCAT 0.974809 -92 ********** Masking position 6 Map Score: 2.91769 Number of sites scoring better than the average of aligned sites = 150 Number in coding regions = 117 Number in noncoding regions = 33 Number of orfs with sites within 600 bp upstream = 34 Fraction of orfs with sites within 600 bp upstream = 0.00546097 Motif number 4 AGAAATAAGAGGGGAAAGAGAGAAAACACT 1 42 0 GGGGAAAGAG 0.995092 -259 TAGAGAGGGGGGAGAAATAAGAGGGGAAAG 1 54 0 GGAGAAATAA 0.990586 -247 ATAATGATAGGGGGAAATAATG 1 289 1 GGGGAAATAA 0.996528 -12 ********** Masking position 5 Map Score: 2.81573 Number of sites scoring better than the average of aligned sites = 49 Number in coding regions = 40 Number in noncoding regions = 9 Number of orfs with sites within 600 bp upstream = 11 Fraction of orfs with sites within 600 bp upstream = 0.00176678 Motif number 5 GATATGTGTGTATAACTCAATTGT 1 5 0 TATAACTCAA 0.984128 -296 TCTATTTCAATAAAACACAAGTCTCGATTG 1 91 1 TAAAACACAA 0.984262 -210 CATAATGTTTTATAATACAAGATGATAGCG 1 249 1 TATAATACAA 0.975738 -52 ********** Masking position 5 Map Score: 1.15638 Number of sites scoring better than the average of aligned sites = 33 Number in coding regions = 25 Number in noncoding regions = 8 Number of orfs with sites within 600 bp upstream = 8 Fraction of orfs with sites within 600 bp upstream = 0.00128493 Motif number 6 TAGCTTTTCTATTTCAATAAAACACAAGTC 1 84 1 ATTTCAATAA 0.97632 -217 TTATGAAAATAATTCCATAATAAACATGCA 1 224 0 AATTCCATAA 0.984734 -77 TTATGGAATTATTTTCATAATGTTTTATAA 1 234 1 ATTTTCATAA 0.97632 -67 ********** Masking position 7 Map Score: 0.720179 Number of sites scoring better than the average of aligned sites = 34 Number in coding regions = 28 Number in noncoding regions = 6 Number of orfs with sites within 600 bp upstream = 5 Fraction of orfs with sites within 600 bp upstream = 0.000803084 Motif number 7 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 9 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0