AlignACE version 2.2 July 7, 1998 alignACE -a/home/amcguire/alignace/lib/ORF_bsub.txt -z/skink1/amcguire/genomes/bsub.fna -iompR_bsub_opreg_300.orf -g0.435 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.435 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 yrpD 300 similar to hypothetical proteins from B. subtilis Motif number 1 GGAAAGAGAGAAAACACTGTAATCAGATAT 1 30 0 AAAACACTGT 0.963916 -271 TATTGAAATAGAAAAGCTATAGAGAGGGGG 1 73 0 GAAAAGCTAT 0.98494 -228 AGTCTCGATTGAAAAGTTATCGTAACATTT 1 110 1 GAAAAGTTAT 0.96595 -191 CTTGTATTATAAAACATTATGAAAATAATT 1 240 0 AAAACATTAT 0.950041 -61 TTATAATTAGAAAACGCTATCATCTTGTAT 1 263 0 AAAACGCTAT 0.978387 -38 ********** Masking position 4 Map Score: 5.05993 Number of sites scoring better than the average of aligned sites = 230 Number in coding regions = 203 Number in noncoding regions = 27 Number of orfs with sites within 600 bp upstream = 40 Fraction of orfs with sites within 600 bp upstream = 0.00642467 Motif number 2 GGGAGAAATAAGAGGGGAAAGAGAGAAAAC 1 45 0 AGAGGGGAAA 0.996458 -256 AAAGCTATAGAGAGGGGGGAGAAATAAGAG 1 61 0 AGAGGGGGGA 0.998452 -240 AATTATAATGATAGGGGGAAATAATG 1 285 1 ATAGGGGGAA 0.996458 -16 ********** Masking position 3 Map Score: 4.03889 Number of sites scoring better than the average of aligned sites = 18 Number in coding regions = 8 Number in noncoding regions = 10 Number of orfs with sites within 600 bp upstream = 10 Fraction of orfs with sites within 600 bp upstream = 0.00160617 Motif number 3 GTAATCAGATATGTGTGTATAACTCAATTG 1 12 0 ATGTGTGTAT 0.979436 -289 ATCTCCTGTGAAGTGTAAATGTTACGATAA 1 126 0 AAGTGTAAAT 0.924341 -175 CACATTATGACTTTGTGCATCTGGCAAACG 1 177 0 CTTTGTGCAT 0.974766 -124 CAAAGTCATAATGTGTAAATTCTGTATCTA 1 192 1 ATGTGTAAAT 0.944991 -109 AATTCTGTATCTATGTGCATGTTTATTATG 1 209 1 CTATGTGCAT 0.974893 -92 ********** Masking position 6 Map Score: 2.91769 Number of sites scoring better than the average of aligned sites = 150 Number in coding regions = 117 Number in noncoding regions = 33 Number of orfs with sites within 600 bp upstream = 34 Fraction of orfs with sites within 600 bp upstream = 0.00546097 Motif number 4 AGTGTTTTCTCTCTTTCCCCTCTTATTTCT 1 42 1 CTCTTTCCCC 0.994858 -259 CTTTCCCCTCTTATTTCTCCCCCCTCTCTA 1 54 1 TTATTTCTCC 0.990139 -247 CATTATTTCCCCCTATCATTAT 1 289 0 TTATTTCCCC 0.996362 -12 ********** Masking position 5 Map Score: 2.81573 Number of sites scoring better than the average of aligned sites = 49 Number in coding regions = 40 Number in noncoding regions = 9 Number of orfs with sites within 600 bp upstream = 11 Fraction of orfs with sites within 600 bp upstream = 0.00176678 Motif number 5 ACAATTGAGTTATACACACATATC 1 5 1 TTGAGTTATA 0.98488 -296 CAATCGAGACTTGTGTTTTATTGAAATAGA 1 91 0 TTGTGTTTTA 0.985022 -210 CGCTATCATCTTGTATTATAAAACATTATG 1 249 0 TTGTATTATA 0.976887 -52 ********** Masking position 10 Map Score: 1.15638 Number of sites scoring better than the average of aligned sites = 33 Number in coding regions = 25 Number in noncoding regions = 8 Number of orfs with sites within 600 bp upstream = 8 Fraction of orfs with sites within 600 bp upstream = 0.00128493 Motif number 6 ACAATTGAGTTATACACACATAT 1 4 1 ATTGAGTTAT 0.97729 -297 TCAATCGAGACTTGTGTTTTATTGAAATAG 1 92 0 CTTGTGTTTT 0.963446 -209 CATGTTTATTATGGAATTATTTTCATAATG 1 226 1 ATGGAATTAT 0.942208 -75 ACGCTATCATCTTGTATTATAAAACATTAT 1 250 0 CTTGTATTAT 0.977257 -51 ********** Masking position 7 Map Score: 0.812966 Number of sites scoring better than the average of aligned sites = 104 Number in coding regions = 90 Number in noncoding regions = 14 Number of orfs with sites within 600 bp upstream = 12 Fraction of orfs with sites within 600 bp upstream = 0.0019274 Motif number 7 AGAGAGAAAACACTGTAATCAGATATGTGTGT 1 24 0 CACTGTAAAG 0.939109 -277 AGAATTTACACATTATGACTTTGTGCATCTGG 1 183 0 CATTATGATT 0.958586 -118 AAAATAATTCCATAATAAACATGCACATAGAT 1 217 0 CATAATAAAT 0.955427 -84 TATTATAAAACATTATGAAAATAATTCCATAA 1 234 0 CATTATGAAT 0.987027 -67 TTCCCCCTATCATTATAATTAGAAAACGCTAT 1 273 0 CATTATAAAG 0.986917 -28 ******** ** Masking position 6 Map Score: 0.158575 Number of sites scoring better than the average of aligned sites = 94 Number in coding regions = 80 Number in noncoding regions = 14 Number of orfs with sites within 600 bp upstream = 15 Fraction of orfs with sites within 600 bp upstream = 0.00240925 Motif number 8 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 9 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 10 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0