AlignACE version 2.2 July 7, 1998 alignACE -a/home/amcguire/genomes/ORF_ctra.txt -z/home/amcguire/genomes/ctra.fna -icpxR6_ctra_opreg_100.orf -g0.413 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.413 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 htrA 138 DO Serine Protease Motif number 1 GATGCAAATCAAGGGGACTACTCTGATGAT 1 27 0 AAGGGGACTA 0.985528 -112 ACAAAATCTAATGATGCAAATCAAGGGGAC 1 39 0 ATGATGCAAA 0.971407 -100 TAGATTTTGTATGCTGCATATCTGCTTGTT 1 59 1 ATGCTGCATA 0.993999 -80 TCTGCTTGTTATGGTGCATAAAATGAAAAA 1 79 1 ATGGTGCATA 0.99771 -60 ATGAAAAAAAAAGGGGCCTAGACGCCCAGA 1 101 1 AAGGGGCCTA 0.99337 -38 ********** Masking position 1 Map Score: 8.75277 Number of sites scoring better than the average of aligned sites = 43 Number in coding regions = 43 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 2 GGGACTACTCTGATGATTCTCCAATCTAAAA 1 13 0 TGTGATTCTC 0.970336 -126 CAAAATCTAATGATGCAAATCAAGGGGACTA 1 37 0 TGTGCAAATC 0.995506 -102 AGATTTTGTATGCTGCATATCTGCTTGTTAT 1 60 1 TGTGCATATC 0.998217 -79 CTGCTTGTTATGGTGCATAAAATGAAAAAAA 1 80 1 TGTGCATAAA 0.982381 -59 ** ******** Masking position 4 Map Score: 3.54543 Number of sites scoring better than the average of aligned sites = 51 Number in coding regions = 50 Number in noncoding regions = 1 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 3 ATGCAAATCAAGGGGACTACTCTGATGATTCT 1 24 0 AGGGGCTACC 0.998877 -115 TGAAAAAAAAAGGGGCCTAGACGCCCAGATCG 1 102 1 AGGGGCTAGC 0.99939 -37 TTCCTTGATAAGCGATCTGGGCGTCTAGGCCC 1 114 0 AGCGACTGGC 0.99633 -25 ***** **** * Masking position 1 Map Score: 1.2221 Number of sites scoring better than the average of aligned sites = 5 Number in coding regions = 5 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 TGATTCTCCAATCTAAAAAA 1 1 0 ATCTAAAAAA 0.927229 -138 AATGATGCAAATCAAGGGGACTACTCTGAT 1 30 0 ATCAAGGGGA 0.974415 -109 GCAGATATGCAGCATACAAAATCTAATGAT 1 54 0 AGCATACAAA 0.898783 -85 TATGCACCATAACAAGCAGATATGCAGCAT 1 69 0 AACAAGCAGA 0.96938 -70 GGTGCATAAAATGAAAAAAAAAGGGGCCTA 1 91 1 ATGAAAAAAA 0.922141 -48 CAGATCGCTTATCAAGGAAAAG 1 127 1 ATCAAGGAAA 0.992103 -12 ********** Masking position 1 Map Score: 2.73741 Number of sites scoring better than the average of aligned sites = 646 Number in coding regions = 646 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -9.70439e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -9.70439e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -9.70439e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0