AlignACE version 2.2 July 7, 1998 alignACE -a/home/amcguire/genomes/ORF_ctra.txt -z/home/amcguire/genomes/ctra.fna -icpxR6_ctra_opreg_300.orf -g0.413 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.413 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 sucC 69 Succinyl-CoA Synthetase, Beta #2 htrA 138 DO Serine Protease Motif number 1 TGAGTAATCAAAGTTGATTGAAG 1 2 1 GAGAATAAAG 0.974503 -68 GAAGTAAAAAGAATAATAAAAGATAAGGAGGA 1 30 1 GAAAATAAAG 0.992014 -40 AGATAAGGAGGAAAAATTAAAGGGTTATTT 1 50 1 GAAAATAAAG 0.992014 -20 TTAGATTGGAGAATCATCAGAGTAGTCCCCTT 2 15 1 GAACATAGAG 0.99532 -124 CCCTTGATTTGCATCATTAGATTTTGTATGCT 2 42 1 GCACATAGAT 0.980085 -97 AAGCAGATATGCAGCATACAAAATCTAATGAT 2 54 0 GCACATCAAA 0.96989 -85 TTCATTTTATGCACCATAACAAGCAGATATGC 2 74 0 GCACATACAA 0.979236 -65 *** *** **** Masking position 6 Map Score: 9.11361 Number of sites scoring better than the average of aligned sites = 94 Number in coding regions = 94 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 2 TATCTTTTATTATTCTTTTTACTTCAATCA 1 25 0 TATTCTTTTT 0.915894 -45 CTTTAATTTTTCCTCCTTATCTTTTATTAT 1 42 0 TCCTCCTTAT 0.950668 -28 ATCAGAGTAGTCCCCTTGATTTGCATCATT 2 30 1 TCCCCTTGAT 0.990107 -109 ATGCTGCATATCTGCTTGTTATGGTGCATA 2 69 1 TCTGCTTGTT 0.975761 -70 GCCCCTTTTTTTTTCATTTTATGCACCATA 2 88 0 TTTTCATTTT 0.825704 -51 GGGCGTCTAGGCCCCTTTTTTTTTCATTTT 2 98 0 GCCCCTTTTT 0.970764 -41 CTTTTCCTTGATAAGCGATCTG 2 127 0 TTTCCTTGAT 0.965521 -12 ********** Masking position 7 Map Score: 4.50967 Number of sites scoring better than the average of aligned sites = 617 Number in coding regions = 615 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 3 AAAGTTGATTGAAGTAAAAAGAATAATAAA 1 20 1 GAAGTAAAAA 0.925617 -50 TAAAAGATAAGGAGGAAAAATTAAAGGGTT 1 46 1 GGAGGAAAAA 0.96614 -24 AAAATCTAATGATGCAAATCAAGGGGACTA 2 37 0 GATGCAAATC 0.978986 -102 GATTTTGTATGCTGCATATCTGCTTGTTAT 2 61 1 GCTGCATATC 0.968703 -78 TGCTTGTTATGGTGCATAAAATGAAAAAAA 2 81 1 GGTGCATAAA 0.987093 -58 ********** Masking position 6 Map Score: 1.5864 Number of sites scoring better than the average of aligned sites = 213 Number in coding regions = 212 Number in noncoding regions = 1 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 AATCATCAGAGTAGTCCCCTTGATTTGCAT 2 26 1 GTAGTCCCCT 0.997378 -113 ATCTGGGCGTCTAGGCCCCTTTTTTTTTCA 2 102 0 CTAGGCCCCT 0.996603 -37 ********** Masking position 3 Map Score: 0.355481 Number of sites scoring better than the average of aligned sites = 2 Number in coding regions = 2 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -2.59896e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -2.59896e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -2.59896e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0