AlignACE version 2.2 July 7, 1998 alignACE -a/home/amcguire/genomes/ORF_ctra.txt -z/home/amcguire/genomes/ctra.fna -icpxR9_ctra_opreg_100.orf -g0.413 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.413 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 htrA 138 DO Serine Protease Motif number 1 GATGCAAATCAAGGGGACTACTCTGATGAT 1 27 0 AAGGGGACTA 0.985767 -112 ACAAAATCTAATGATGCAAATCAAGGGGAC 1 39 0 ATGATGCAAA 0.971887 -100 TAGATTTTGTATGCTGCATATCTGCTTGTT 1 59 1 ATGCTGCATA 0.994102 -80 TCTGCTTGTTATGGTGCATAAAATGAAAAA 1 79 1 ATGGTGCATA 0.997748 -60 ATGAAAAAAAAAGGGGCCTAGACGCCCAGA 1 101 1 AAGGGGCCTA 0.99335 -38 ********** Masking position 1 Map Score: 8.75277 Number of sites scoring better than the average of aligned sites = 43 Number in coding regions = 43 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 2 TTTTAGATTGGAGAATCATCAGAGTAGTCCC 1 13 1 GAGAATCACA 0.973965 -126 TAGTCCCCTTGATTTGCATCATTAGATTTTG 1 37 1 GATTTGCACA 0.996069 -102 ATAACAAGCAGATATGCAGCATACAAAATCT 1 60 0 GATATGCACA 0.99844 -79 TTTTTTTCATTTTATGCACCATAACAAGCAG 1 80 0 TTTATGCACA 0.984559 -59 ******** ** Masking position 8 Map Score: 3.54543 Number of sites scoring better than the average of aligned sites = 51 Number in coding regions = 50 Number in noncoding regions = 1 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 3 ATGCAAATCAAGGGGACTACTCTGATGATTCT 1 24 0 AGGGGCTACC 0.998868 -115 TGAAAAAAAAAGGGGCCTAGACGCCCAGATCG 1 102 1 AGGGGCTAGC 0.999385 -37 TTCCTTGATAAGCGATCTGGGCGTCTAGGCCC 1 114 0 AGCGACTGGC 0.996301 -25 ***** **** * Masking position 1 Map Score: 1.2221 Number of sites scoring better than the average of aligned sites = 5 Number in coding regions = 5 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 TTTTTTAGATTGGAGAATCA 1 1 1 TTTTTTAGAT 0.965982 -138 ATCAGAGTAGTCCCCTTGATTTGCATCATT 1 30 1 TCCCCTTGAT 0.983374 -109 TAGGCCCCTTTTTTTTTCATTTTATGCACC 1 91 0 TTTTTTTCAT 0.964034 -48 CTTTTCCTTGATAAGCGATCTG 1 127 0 TTTCCTTGAT 0.994216 -12 ********** Masking position 6 Map Score: 1.96755 Number of sites scoring better than the average of aligned sites = 155 Number in coding regions = 155 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -9.70439e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -9.70439e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -9.70439e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0