AlignACE version 2.2 July 7, 1998 alignACE -a/home/amcguire/genomes/ORF_ctra.txt -z/home/amcguire/genomes/ctra.fna -icpxR_ctra_opreg_100.orf -g0.413 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.413 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 htrA 138 DO Serine Protease Motif number 1 ATCATCAGAGTAGTCCCCTTGATTTGCATC 1 27 1 TAGTCCCCTT 0.984126 -112 GTCCCCTTGATTTGCATCATTAGATTTTGT 1 39 1 TTTGCATCAT 0.968594 -100 AACAAGCAGATATGCAGCATACAAAATCTA 1 59 0 TATGCAGCAT 0.993393 -80 TTTTTCATTTTATGCACCATAACAAGCAGA 1 79 0 TATGCACCAT 0.997486 -60 TCTGGGCGTCTAGGCCCCTTTTTTTTTCAT 1 101 0 TAGGCCCCTT 0.993446 -38 ********** Masking position 1 Map Score: 8.75277 Number of sites scoring better than the average of aligned sites = 43 Number in coding regions = 43 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 2 TTTAGATTGGAGAATCATCAGAGTAGTCCCCT 1 14 1 AGAACATAGA 0.986708 -125 CCCCTTGATTTGCATCATTAGATTTTGTATGC 1 41 1 TGCACATAGA 0.998636 -98 CAAGCAGATATGCAGCATACAAAATCTAATGA 1 55 0 TGCACATCAA 0.993797 -84 TTTCATTTTATGCACCATAACAAGCAGATATG 1 75 0 TGCACATACA 0.997499 -64 **** *** *** Masking position 7 Map Score: 4.26123 Number of sites scoring better than the average of aligned sites = 16 Number in coding regions = 16 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 3 TGATGCAAATCAAGGGGACTACTCTGATGA 1 28 0 CAAGGGGACT 0.998319 -111 AATGAAAAAAAAAGGGGCCTAGACGCCCAG 1 100 1 AAAGGGGCCT 0.998311 -39 ********** Masking position 3 Map Score: 1.16254 Number of sites scoring better than the average of aligned sites = 7 Number in coding regions = 7 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 TGATTCTCCAATCTAAAAAA 1 1 0 ATCTAAAAAA 0.96432 -138 AATGATGCAAATCAAGGGGACTACTCTGAT 1 30 0 ATCAAGGGGA 0.982544 -109 GGTGCATAAAATGAAAAAAAAAGGGGCCTA 1 91 1 ATGAAAAAAA 0.962275 -48 CAGATCGCTTATCAAGGAAAAG 1 127 1 ATCAAGGAAA 0.993923 -12 ********** Masking position 5 Map Score: 1.96755 Number of sites scoring better than the average of aligned sites = 155 Number in coding regions = 155 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -9.70439e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -9.70439e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -9.70439e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0