AlignACE version 2.2 July 7, 1998 alignACE -a/home/amcguire/genomes/ORF_ctra.txt -z/home/amcguire/genomes/ctra.fna -icpxR_ctra_opreg_300.orf -g0.413 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.413 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 sucC 69 Succinyl-CoA Synthetase, Beta #2 htrA 138 DO Serine Protease Motif number 1 CTTCAATCAACTTTGATTACTCA 1 2 0 CTTTATTCTC 0.974503 -68 TCCTCCTTATCTTTTATTATTCTTTTTACTTC 1 30 0 CTTTATTTTC 0.992014 -40 AAATAACCCTTTAATTTTTCCTCCTTATCT 1 50 0 CTTTATTTTC 0.992014 -20 AAGGGGACTACTCTGATGATTCTCCAATCTAA 2 15 0 CTCTATGTTC 0.99532 -124 AGCATACAAAATCTAATGATGCAAATCAAGGG 2 42 0 ATCTATGTGC 0.980085 -97 ATCATTAGATTTTGTATGCTGCATATCTGCTT 2 54 1 TTTGATGTGC 0.96989 -85 GCATATCTGCTTGTTATGGTGCATAAAATGAA 2 74 1 TTGTATGTGC 0.979236 -65 **** *** *** Masking position 6 Map Score: 9.11361 Number of sites scoring better than the average of aligned sites = 94 Number in coding regions = 94 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 2 TGATTGAAGTAAAAAGAATAATAAAAGATA 1 25 1 AAAAAGAATA 0.91067 -45 ATAATAAAAGATAAGGAGGAAAAATTAAAG 1 42 1 ATAAGGAGGA 0.94748 -28 AATGATGCAAATCAAGGGGACTACTCTGAT 2 30 0 ATCAAGGGGA 0.989439 -109 TATGCACCATAACAAGCAGATATGCAGCAT 2 69 0 AACAAGCAGA 0.97415 -70 TATGGTGCATAAAATGAAAAAAAAAGGGGC 2 88 1 AAAATGAAAA 0.816004 -51 AAAATGAAAAAAAAAGGGGCCTAGACGCCC 2 98 1 AAAAAGGGGC 0.968832 -41 CAGATCGCTTATCAAGGAAAAG 2 127 1 ATCAAGGAAA 0.963255 -12 ********** Masking position 4 Map Score: 4.50967 Number of sites scoring better than the average of aligned sites = 617 Number in coding regions = 615 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 3 CAAAGTTGATTGAAGTAAAAAGAATAATAA 1 19 1 TGAAGTAAAA 0.915165 -51 CAAAATCTAATGATGCAAATCAAGGGGACT 2 38 0 TGATGCAAAT 0.987506 -101 AGATTTTGTATGCTGCATATCTGCTTGTTA 2 60 1 TGCTGCATAT 0.985797 -79 CTGCTTGTTATGGTGCATAAAATGAAAAAA 2 80 1 TGGTGCATAA 0.946275 -59 ********** Masking position 7 Map Score: 2.48857 Number of sites scoring better than the average of aligned sites = 51 Number in coding regions = 51 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ATGCAAATCAAGGGGACTACTCTGATGATT 2 26 0 AGGGGACTAC 0.997589 -113 TGAAAAAAAAAGGGGCCTAGACGCCCAGAT 2 102 1 AGGGGCCTAG 0.996581 -37 ********** Masking position 8 Map Score: 0.355481 Number of sites scoring better than the average of aligned sites = 2 Number in coding regions = 2 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -2.59896e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -2.59896e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -2.59896e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0