AlignACE version 2.2 July 7, 1998 alignACE -a/home/amcguire/genomes/ORF_ctra.txt -z/home/amcguire/genomes/ctra.fna -icspA_ctra_opreg_100.orf -g0.413 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.413 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 CT191 146 hypothetical protein Motif number 1 GAAGGCTCAGGAAGAAGGCTCTTATACTTG 1 88 0 GAAGAAGGCT 0.998232 -59 ACCTTCCTTCGCAGAAGGCTCAGGAAGAAG 1 101 0 GCAGAAGGCT 0.99699 -46 AGCCTTCTGCGAAGGAAGGTGTGCTTGCGC 1 111 1 GAAGGAAGGT 0.995472 -36 TGCGCATATCGAAGGAGCGTT 1 136 1 GAAGGAGCGT 0.99694 -11 ********** Masking position 6 Map Score: 7.86631 Number of sites scoring better than the average of aligned sites = 36 Number in coding regions = 36 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 2 ATCCAAGGATTTACTAGAACTTAGCGCTAA 1 34 1 TTACTAGAAC 0.913241 -113 AAAAGTCAAAGTATTAGCGCTAAGTTCTAG 1 47 0 GTATTAGCGC 0.976183 -100 TTCGCAACAAGTATAAGAGCCTTCTTCCTG 1 81 1 GTATAAGAGC 0.98721 -66 GAAGGAAGGTGTGCTTGCGCATATCGAAGG 1 121 1 GTGCTTGCGC 0.589185 -26 ********** Masking position 2 Map Score: 2.73658 Number of sites scoring better than the average of aligned sites = 64 Number in coding regions = 64 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 3 ********** No masking Map Score: -1.17788e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -1.17788e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.17788e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0