AlignACE version 2.2 July 7, 1998 alignACE -a/home/amcguire/genomes/ORF_ctra.txt -z/home/amcguire/genomes/ctra.fna -igcvA_ctra_opreg_100.orf -g0.413 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.413 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 CT283 170 hypothetical protein Motif number 1 AATAGGGAGGGAGGATCTGTACAGATCCTC 1 18 1 GAGGATCTGT 0.994427 -153 AGACCGAAGGGAGGATCTGTACAGATCCTC 1 28 0 GAGGATCTGT 0.994427 -143 GAGATCCCTCTAGAATATCTCATGGTACTT 1 93 0 TAGAATATCT 0.897018 -78 GATATTCTAGAGGGATCTCTTTCTCTCTTC 1 104 1 AGGGATCTCT 0.845071 -67 TCTCTTCGTAAAGGAATTCTGTAGAAGTAG 1 127 1 AAGGAATTCT 0.977327 -44 TAAGAAAAAAAAGGAAAACTACTTCTACAG 1 145 0 AAGGAAAACT 0.949509 -26 ********** Masking position 5 Map Score: 7.26211 Number of sites scoring better than the average of aligned sites = 328 Number in coding regions = 328 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 2 CTGTACAGATCCTCCCTCCCTATTAGAAGA 1 12 0 CCTCCCTCCC 0.998322 -159 CTGTACAGATCCTCCCTTCGGTCTTTGTCC 1 34 1 CCTCCCTTCG 0.999231 -137 GGGATCTCTTTCTCTCTTCGTAAAGGAATT 1 115 1 TCTCTCTTCG 0.994322 -56 ********** Masking position 7 Map Score: 4.27257 Number of sites scoring better than the average of aligned sites = 10 Number in coding regions = 10 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 3 ********** No masking Map Score: -4.02577e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -4.02577e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -4.02577e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0