AlignACE version 2.2 July 7, 1998 alignACE -a/home/amcguire/genomes/ORF_ctra.txt -z/home/amcguire/genomes/ctra.fna -imetR_ctra_opreg_100.orf -g0.413 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.413 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 glyA 300 Serine Hydroxymethyltransferase #2 CT623 200 CHLPN 76kDa Homolog Motif number 1 AGAAGCTTCCTACTAGGAAAAAAGCTT 1 1 0 TAGAAAAAAT 0.933481 -300 GATCATATTCTTACAGCAAAAGTCAAGAAGCTTCCTA 1 26 0 TAGAAAAGTG 0.987364 -275 TATGGTAAGCGACTAGGGAAAATGGGGCGCTTGGTAA 1 93 1 GAGGAAAATG 0.781768 -208 TAACTATAACTATAAGAAAAAGAAACGATGCTTCCAA 1 135 0 TAGAAAAGAG 0.987364 -166 CTAAACTTTCTAGGAGAAAGAGGATTTATTTTAACTA 1 166 0 TAGAAGAGGT 0.938679 -135 GTTTAGACTTTCTCATCAAAAGATTAGATTCCCATAA 1 197 1 TATAAAAGAG 0.908144 -104 TCCCATAAAGGATAAGGGAGAGTGGGTAGAGGATAAA 1 226 1 GAGGAGAGTT 0.888072 -75 AGAGTGGGTAGAGGATAAAGAGTGCCTCTGCAAGGTC 1 244 1 GATAAGAGTT 0.760626 -57 GTTCTATTCTTAAGAGAAAAAGATGTCCTAAGAGACT 2 20 0 TAGAAAAGAC 0.937586 -181 AGAACTGTATTTTTAGAAAAAATCCTTCCTGAGCTAT 2 52 1 TAGAAAAATT 0.933481 -149 ATCATGCTTATGTAAGTAAGAGATTTGTAACCGTTTG 2 108 1 TAGAAGAGAG 0.987597 -93 TTTGTAACCGTTTGCGAAAAAATCAAGCGTCCCAGGA 2 131 1 TCGAAAAATG 0.779864 -70 AAATCAAGCGTCCCAGGAAGAGAGATTTCCGTGAGCA 2 150 1 TAGAAGAGAT 0.980295 -51 * ** ****** * Masking position 9 Map Score: 12.8248 Number of sites scoring better than the average of aligned sites = 567 Number in coding regions = 566 Number in noncoding regions = 1 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 2 AAAAGTCAAGAAGCTTCCTACTAGGAAAAA 1 16 0 AAGCTTCCTA 0.988182 -285 GACCATTACCAAGCGCCCCATTTTCCCTAG 1 105 0 AAGCGCCCCA 0.993771 -196 AAAAGAAACGATGCTTCCAAGACCATTACC 1 125 0 ATGCTTCCAA 0.96219 -176 ATCAAAAGATTAGATTCCCATAAAGGATAA 1 211 1 TAGATTCCCA 0.950906 -90 CGAAAAAATCAAGCGTCCCAGGAAGAGAGA 2 145 1 AAGCGTCCCA 0.997216 -56 ********** Masking position 10 Map Score: 5.11113 Number of sites scoring better than the average of aligned sites = 54 Number in coding regions = 54 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 3 TTTCCTAGTAGGAAGCTTCTTGACTTTTGCT 1 18 1 GGAAGCTTCT 0.994036 -283 AGGGAAAATGGGGCGCTTGGTAATGGTCTTG 1 107 1 GGGCGCTTGT 0.987816 -194 TAATGGTCTTGGAAGCATCGTTTCTTTTTCT 1 127 1 GGAAGCATCT 0.991477 -174 CTATAGCTCAGGAAGGATTTTTTCTAAAAAT 2 60 0 GGAAGGATTT 0.923738 -141 TCTCTTCCTGGGACGCTTGATTTTTTCGCAA 2 142 0 GGACGCTTGT 0.994474 -59 ********* * Masking position 8 Map Score: 4.03032 Number of sites scoring better than the average of aligned sites = 26 Number in coding regions = 26 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 GAATATGATCAACTGAAGCTGCAATGGTAT 1 53 1 AACTGAAGCT 0.962853 -248 GATTTATTTTAACTATAACTATAAGAAAAA 1 151 0 AACTATAACT 0.90811 -150 TTAAGAATAGAACTGTATTTTTAGAAAAAA 2 44 1 AACTGTATTT 0.853388 -157 CCAAGCCAAAAACTATAGCTCAGGAAGGAT 2 73 0 AACTATAGCT 0.61187 -128 ********** Masking position 4 Map Score: 1.07089 Number of sites scoring better than the average of aligned sites = 18 Number in coding regions = 18 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 AAGCTTTTTTCCTAGTAGGAAGCTTCTTG 1 10 1 TCCTAGTAGG 0.970812 -291 AGTCTAAACTTTCTAGGAGAAAGAGGATTT 1 176 0 TTCTAGGAGA 0.98267 -125 GAAAAAGATGTCCTAAGAGACTAGCTTACA 2 12 0 TCCTAAGAGA 0.993074 -189 ACAGTTCTATTCTTAAGAGAAAAAGATGTC 2 30 0 TCTTAAGAGA 0.971981 -171 ********** Masking position 5 Map Score: 1.97707 Number of sites scoring better than the average of aligned sites = 25 Number in coding regions = 25 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 8.55083e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 8.55083e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: 8.55083e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0