AlignACE version 2.2 July 7, 1998 alignACE -a/home/amcguire/genomes/ORF_ctra.txt -z/home/amcguire/genomes/ctra.fna -irpoE_ctra_opreg_100.orf -g0.413 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.413 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 htrA 138 DO Serine Protease Motif number 1 ATCATCAGAGTAGTCCCCTTGATTTGCATC 1 27 1 TAGTCCCCTT 0.985754 -112 GTCCCCTTGATTTGCATCATTAGATTTTGT 1 39 1 TTTGCATCAT 0.97186 -100 AACAAGCAGATATGCAGCATACAAAATCTA 1 59 0 TATGCAGCAT 0.994096 -80 TTTTTCATTTTATGCACCATAACAAGCAGA 1 79 0 TATGCACCAT 0.997746 -60 TCTGGGCGTCTAGGCCCCTTTTTTTTTCAT 1 101 0 TAGGCCCCTT 0.993351 -38 ********** Masking position 1 Map Score: 8.75277 Number of sites scoring better than the average of aligned sites = 43 Number in coding regions = 43 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 2 TTTAGATTGGAGAATCATCAGAGTAGTCCCCT 1 14 1 AGAACATAGA 0.985438 -125 CCCCTTGATTTGCATCATTAGATTTTGTATGC 1 41 1 TGCACATAGA 0.998508 -98 CAAGCAGATATGCAGCATACAAAATCTAATGA 1 55 0 TGCACATCAA 0.9932 -84 TTTCATTTTATGCACCATAACAAGCAGATATG 1 75 0 TGCACATACA 0.997264 -64 **** *** *** Masking position 7 Map Score: 4.26123 Number of sites scoring better than the average of aligned sites = 16 Number in coding regions = 16 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 3 TCATCAGAGTAGTCCCCTTGATTTGCATCA 1 28 1 AGTCCCCTTG 0.9984 -111 CTGGGCGTCTAGGCCCCTTTTTTTTTCATT 1 100 0 AGGCCCCTTT 0.998392 -39 ********** Masking position 8 Map Score: 1.16254 Number of sites scoring better than the average of aligned sites = 7 Number in coding regions = 7 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 TTTTTTAGATTGGAGAATCA 1 1 1 TTTTTTAGAT 0.96432 -138 ATCAGAGTAGTCCCCTTGATTTGCATCATT 1 30 1 TCCCCTTGAT 0.982544 -109 TAGGCCCCTTTTTTTTTCATTTTATGCACC 1 91 0 TTTTTTTCAT 0.962275 -48 CTTTTCCTTGATAAGCGATCTG 1 127 0 TTTCCTTGAT 0.993923 -12 ********** Masking position 6 Map Score: 1.96755 Number of sites scoring better than the average of aligned sites = 155 Number in coding regions = 155 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -9.70439e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -9.70439e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -9.70439e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0