AlignACE version 2.2 July 7, 1998 alignACE -a/home/amcguire/alignace/lib/ORF_synecho.txt -z/skink1/amcguire/genomes/synecho.fna -iaraC_synecho_opreg_100.orf -g0.48 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.48 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 1653104 300 hypothetical protein #2 1653417 148 hypothetical protein #3 1653418 86 hypothetical protein Motif number 1 AATTTGAATGATAAGTTTTACTATTATTTG 1 45 0 ATAAGTTTTA 0.977442 -256 CTAAGTAATTTTAAATTTGAATGATAAGTT 1 58 0 TTAAATTTGA 0.845042 -243 GGATTTACATATAGACTTTAGCTTATAGAT 1 119 1 ATAGACTTTA 0.9347 -182 ACTTTAGCTTATAGATTTCAAGACATAGGC 1 133 1 ATAGATTTCA 0.951791 -168 CCCAATCCCCATAAATTTCAACCAAGGAGA 1 270 1 ATAAATTTCA 0.975092 -31 TTTTCTGGAAATAAATTTGATGAATTATAA 2 18 1 ATAAATTTGA 0.975092 -131 GGGTAATGGTAAAAGTTTTAAAATTTTATA 2 43 0 AAAAGTTTTA 0.898364 -106 ACAAAAATCAATAAATTTTAATGAATTAGT 2 96 0 ATAAATTTTA 0.977967 -53 AATATATCAAAAAAGCTTTATTATTTTTCG 3 36 1 AAAAGCTTTA 0.851693 -51 ********** Masking position 7 Map Score: 11.832 Number of sites scoring better than the average of aligned sites = 121 Number in coding regions = 87 Number in noncoding regions = 34 Number of orfs with sites within 600 bp upstream = 38 Fraction of orfs with sites within 600 bp upstream = 0.00610344 Motif number 2 GATCGCCAGCTTTTTGGGGACTAGATGGTG 1 13 0 TTTTTGGGGA 0.947317 -288 GTTTTACTATTATTTGGCGATCGCCAGCTT 1 31 0 TATTTGGCGA 0.905253 -270 ACTTAGCAGATCCAGGGGGACAACTGCAAA 1 82 1 TCCAGGGGGA 0.994368 -219 CAAGAGTCTATACAGAGCGAAGCCAATGGG 1 180 1 TACAGAGCGA 0.92396 -121 GCTTGATCTTTCCAGGGGCAATGAACCCCA 1 206 0 TCCAGGGGCA 0.987668 -95 CTGCCGAAGATTCAGGGCCAAGCTTTACTA 1 239 1 TTCAGGGCCA 0.982653 -62 TTGGTTGAAATTTATGGGGATTGGGGTAGT 1 265 0 TTTATGGGGA 0.976377 -36 ********** Masking position 10 Map Score: 6.54333 Number of sites scoring better than the average of aligned sites = 1265 Number in coding regions = 1089 Number in noncoding regions = 176 Number of orfs with sites within 600 bp upstream = 172 Fraction of orfs with sites within 600 bp upstream = 0.0276261 Motif number 3 GCAGTTGTCCCCCTGGATCTGCTAAGTAATTT 1 77 0 CCCTGATCTC 0.993936 -224 AGGCATTCAAACCTGCATAGACAAGAGTCTAT 1 159 1 ACCTGATAGC 0.982879 -142 ATTGGCTTCGCTCTGTATAGACTCTTGTCTAT 1 175 0 CTCTGATAGC 0.98814 -126 GGTTCATTGCCCCTGGAAAGATCAAGCAAACT 1 209 1 CCCTGAAAGT 0.935441 -92 TAAAGCTTGGCCCTGAATCTTCGGCAGTTTGC 1 234 0 CCCTGATCTC 0.993937 -67 AATTGAAGTTGTCTGAAGCGTCTCAATATATC 3 12 1 GTCTGAGCGC 0.954471 -75 ***** **** * Masking position 7 Map Score: 3.54797 Number of sites scoring better than the average of aligned sites = 267 Number in coding regions = 247 Number in noncoding regions = 20 Number of orfs with sites within 600 bp upstream = 20 Fraction of orfs with sites within 600 bp upstream = 0.00321234 Motif number 4 CGATCGCCAGCTTTTTGGGGACTAGATGGT 1 14 0 CTTTTTGGGG 0.967618 -287 AGTTTTACTATTATTTGGCGATCGCCAGCT 1 32 0 TTATTTGGCG 0.932847 -269 CTTGGTTGAAATTTATGGGGATTGGGGTAG 1 266 0 ATTTATGGGG 0.913614 -35 TCTTATTTTTTCTGGAAATAAATTT 2 6 1 TTTTTTCTGG 0.94944 -143 AAATTTATTGATTTTTGTCGCGAGCACTTT 2 108 1 ATTTTTGTCG 0.970057 -41 AAGCTTTATTATTTTTCGCACTATTTTCTC 3 48 1 ATTTTTCGCA 0.868554 -39 TTTTTCGCACTATTTTCTCGACTCATCCCT 3 59 1 TATTTTCTCG 0.836619 -28 ********** Masking position 6 Map Score: 2.51483 Number of sites scoring better than the average of aligned sites = 979 Number in coding regions = 823 Number in noncoding regions = 156 Number of orfs with sites within 600 bp upstream = 173 Fraction of orfs with sites within 600 bp upstream = 0.0277867 Motif number 5 TCCAGGGGGACAACTGCAAAATTGGTCGGA 1 92 1 CAACTGCAAA 0.979643 -209 TACCATTACCCAACTTCACTGGACAAATTA 2 62 1 CAACTTCACT 0.988353 -87 ACGCTTCAGACAACTTCAATTA 3 3 0 CAACTTCAAT 0.990192 -84 ********** Masking position 3 Map Score: 0.718945 Number of sites scoring better than the average of aligned sites = 37 Number in coding regions = 30 Number in noncoding regions = 7 Number of orfs with sites within 600 bp upstream = 6 Fraction of orfs with sites within 600 bp upstream = 0.000963701 Motif number 6 ********** No masking Map Score: 4.50646e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 4.50646e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: 4.50646e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0