AlignACE version 2.2 July 7, 1998 alignACE -a/home/amcguire/alignace/lib/ORF_synecho.txt -z/skink1/amcguire/genomes/synecho.fna -irhaS_synecho_opreg_100.orf -g0.48 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.48 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 pchR 242 regulatory protein PchR Motif number 1 CTCTCATCGTTATTGAGATAATCCACAAGGT 1 42 1 TATTGAGAAA 0.990447 -201 GTGCTGTGGCGATTGGGACAACCTTGTGGAT 1 62 0 GATTGGGAAA 0.992665 -181 GCAGTATATTTGTTGGAAAAATGTGCTGTGG 1 84 0 TGTTGGAAAA 0.978807 -159 GGGTTTAATTTATTGAGCAAAGCCCTAACGG 1 128 0 TATTGAGCAA 0.974319 -115 CCATCAAATATTTAGGAATAATTTGCATTAG 1 157 1 TTTAGGAAAA 0.886158 -86 AGCTGAAGTAGATTGAAAGAATTGATCAATC 1 201 0 GATTGAAAAA 0.982059 -42 ******** ** Masking position 3 Map Score: 5.59562 Number of sites scoring better than the average of aligned sites = 433 Number in coding regions = 357 Number in noncoding regions = 76 Number of orfs with sites within 600 bp upstream = 77 Fraction of orfs with sites within 600 bp upstream = 0.0123675 Motif number 2 CAAGTAATACCATCTCCTATG 1 1 1 CAATAATACC 0.923285 -242 AGATAATCCACAAGGTTGTCCCAATCGCCAC 1 57 1 CAAGTTGTCC 0.955475 -186 ATCGCCACAGCACATTTTTCCAACAAATATA 1 80 1 CACTTTTTCC 0.986358 -163 ACTCCTAATGCAAATTATTCCTAAATATTTG 1 161 0 CAATTATTCC 0.993707 -82 ATAGATTGATCAATTCTTTCAATCTACTTCA 1 198 1 CAATCTTTCA 0.960679 -45 CAATCTACTTCAGCTTATTCAGCTTCCCATC 1 217 1 CAGTTATTCA 0.960677 -26 *** ******* Masking position 2 Map Score: 3.1131 Number of sites scoring better than the average of aligned sites = 628 Number in coding regions = 553 Number in noncoding regions = 75 Number of orfs with sites within 600 bp upstream = 87 Fraction of orfs with sites within 600 bp upstream = 0.0139737 Motif number 3 CCATCTCCTATGGGACATTGAACTCTCATC 1 20 1 TGGGACATTG 0.989853 -223 TCATCGTTATTGAGATAATCCACAAGGTTG 1 45 1 TGAGATAATC 0.922408 -198 CTGTGGCGATTGGGACAACCTTGTGGATTA 1 60 0 TGGGACAACC 0.987051 -183 GTATATTTGTTGGAAAAATGTGCTGTGGCG 1 82 0 TGGAAAAATG 0.968289 -161 GGGCAGATGGGAAGCTGAATAAGCTGA 1 226 0 TGGGAAGCTG 0.976801 -17 ********** Masking position 5 Map Score: 1.46476 Number of sites scoring better than the average of aligned sites = 747 Number in coding regions = 612 Number in noncoding regions = 135 Number of orfs with sites within 600 bp upstream = 157 Fraction of orfs with sites within 600 bp upstream = 0.0252168 Motif number 4 ********** No masking Map Score: 1.80068e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 1.80068e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 1.80068e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0