AlignACE version 2.2 July 7, 1998 alignACE -z/skink1/amcguire/genomes/ecoli.fna -a/home/amcguire/alignace/lib/ORF_ecoli.txt -b/home/amcguire/alignace/lib/bimes_ecoli.txt -k0 -l300 -jada.reg -g0.5 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 137 Input sequences: #1 alkA 70 bp alkA 282 1-849 CDS #2 ada 73 bp ada 354 1-1065 CDS #3 aidB 68 bp aidB 546 1-1641 CDS Motif number 1 AATAACGTTTATGCTGAAAGCGGATGAATAA 1 41 1 ATGCTGAAGC 0.994577 -30 TTTTTGCGTGATGGTGACCGGGCAGCCTAAA 2 27 1 ATGGTGACGG 0.988662 -47 CACCATTAGTATGGTCACTGCCATGGATTCA 3 38 0 ATGGTCACGC 0.997397 -31 GACCATACTAATGGTGACTGCCATTG 3 53 1 ATGGTGACGC 0.999027 -16 ******** ** Masking position 5 Map Score: 8.47272 Number of sites scoring better than the average of aligned sites = 71 Number in coding regions = 65 Number in noncoding regions = 6 Number of orfs with sites within 600 bp upstream = 6 Fraction of orfs with sites within 600 bp upstream = 0.000963701 Motif number 2 GTTATTCAGACGCTGCGCTTTGCTTTCATA 1 17 0 CGCTGCGCTT 0.99309 -54 ATAGCCTTTAGGCTGCCCGGTCACCATCAC 2 34 0 GGCTGCCCGG 0.99722 -40 GCAGCCTAAAGGCTATCCTTAACCAGGGAG 2 48 1 GGCTATCCTT 0.964414 -26 TTAGTATGGTCACTGCCATGGATTCATGAC 3 34 0 CACTGCCATG 0.989419 -35 TACTAATGGTGACTGCCATTG 3 58 1 GACTGCCATT 0.993158 -11 ********** Masking position 4 Map Score: 5.52882 Number of sites scoring better than the average of aligned sites = 1008 Number in coding regions = 957 Number in noncoding regions = 51 Number of orfs with sites within 600 bp upstream = 54 Fraction of orfs with sites within 600 bp upstream = 0.00867331 Motif number 3 TCAGCATAAACGTTATTCAGACGCTGCGCTTTGC 1 24 0 CTTATTCCGC 0.998335 -47 CGCATCTCCTTATTCATCCGCTTTCAGCATA 1 50 0 CTTATTCCGC 0.998317 -21 ACGCAAAAACCAACAATCTTGCGCT 2 2 0 CACAATCCGC 0.995012 -72 CTCTTTCTGTCATGAATCCATGGCAGTGACCATA 3 26 1 CTGAATCGGC 0.99471 -43 * ****** *** Masking position 7 Map Score: 2.17963 Number of sites scoring better than the average of aligned sites = 107 Number in coding regions = 98 Number in noncoding regions = 9 Number of orfs with sites within 600 bp upstream = 11 Fraction of orfs with sites within 600 bp upstream = 0.00176678 Motif number 4 TCCGCTTTCAGCATAAACGTTATTCAGACG 1 35 0 GCATAAACGT 0.988987 -36 TCACCATCACGCAAAAACCAACAATCTTGC 2 14 0 GCAAAAACCA 0.989037 -60 GAAAGAGATTGCTAAAACATTC 3 3 0 GCTAAAACAT 0.983837 -66 ********** Masking position 5 Map Score: 0.400092 Number of sites scoring better than the average of aligned sites = 169 Number in coding regions = 145 Number in noncoding regions = 24 Number of orfs with sites within 600 bp upstream = 31 Fraction of orfs with sites within 600 bp upstream = 0.00497912 Motif number 5 ********** No masking Map Score: -4.73059e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -4.73059e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -4.73059e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0