AlignACE version 2.2  July 7, 1998
alignACE -z/skink1/amcguire/genomes/ecoli.fna -a/home/amcguire/alignace/lib/ORF_ecoli.txt -b/home/amcguire/alignace/lib/bimes_ecoli.txt -k0 -l300 -jcynR.reg -g0.5 -x5 
Parameter values:
 expect =  	5
 ncols =   	10
 npass =   	1000
 maxnpass =	100
 nruns =   	1000
 maxnruns =	100
 repeat =  	15
 maxreps = 	3
 nread =   	500
 ncycles = 	1
 fragment =	1
 psfact =  	0.1
 gcback =  	0.5
 maxlen =  	30
 weight =  	0.8
 exclude = 	182

Input sequences:
#1	cynR_cynT 108 bp cynR 299 1-900 CDS
 cynT 219 1-660 CDS

Motif number 1

CTCTGGAATGAGAGGCAGACTACTCGCCGA	1	72	0	AGAGGCAGAC	    0.999277	-37
CTCTCATTCCAGAGACAGACAGAGGTTAAC	1	88	1	AGAGACAGAC	    0.998037	-21
AGAGACAGACAGAGGTTAACG         	1	98	1	AGAGGTTAAC	    0.990631	-11
          **********

Masking position 3
Map Score:   5.00699

Number of sites scoring better than the average of aligned sites = 31
Number in coding regions = 29
Number in noncoding regions = 2
Number of orfs with sites within 600 bp upstream = 2
Fraction of orfs with sites within 600 bp upstream = 0.000321234


Motif number 2

          **********

No masking
Map Score:   1.37435e-13

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0


Motif number 3

          **********

No masking
Map Score:   1.37435e-13

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0


Motif number 4

          **********

No masking
Map Score:   1.37435e-13

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0