AlignACE version 2.2 July 7, 1998 alignACE -a/home/amcguire/genomes/ORF_ecoli.txt -z/home/amcguire/genomes/ecoli.fna -ifarR_ecoli_opreg_100.orf -g0.5 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 farR 108 transcriptional regulator of succinylCoA synthetase operon Motif number 1 TGATTGAAATTATTTGTATTGTATTTGTAT 1 29 1 TATTTGTATT 0.994229 -80 ATTTGTATTGTATTTGTATTATTTACAGGA 1 40 1 TATTTGTATT 0.994229 -69 ATAATGGTTAAATTCGTATTAATGAGATAC 1 84 1 AATTCGTATT 0.758849 -25 TTTTAGTATCTCATTAATAC 1 99 0 TTTTAGTATC 0.970833 -10 ********** Masking position 4 Map Score: 6.6407 Number of sites scoring better than the average of aligned sites = 32 Number in coding regions = 25 Number in noncoding regions = 7 Number of orfs with sites within 600 bp upstream = 7 Fraction of orfs with sites within 600 bp upstream = 0.00112432 Motif number 2 ATCAAGTGAAATTGATCACATA 1 1 0 ATTATCAATA 0.994802 -108 CATCCTGTAAATAATACAAATACAATACAAAT 1 40 0 ATATACAATA 0.925033 -69 TGCCCGATAAATTCATCCTGTAAATAATACAA 1 53 0 ATTATCCGTA 0.991816 -56 ATTAATACGAATTTAACCATTATGCCCGATAA 1 75 0 ATTAACCTTA 0.982778 -34 TTAAATTCGTATTAATGAGATACTAAAA 1 91 1 ATTATGAATA 0.981935 -18 *** **** *** Masking position 2 Map Score: 2.70741 Number of sites scoring better than the average of aligned sites = 236 Number in coding regions = 181 Number in noncoding regions = 55 Number of orfs with sites within 600 bp upstream = 68 Fraction of orfs with sites within 600 bp upstream = 0.0109219 Motif number 3 ********** No masking Map Score: 1.37435e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: 1.37435e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 1.37435e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0