AlignACE version 2.2 July 7, 1998 alignACE -z/skink1/amcguire/genomes/ecoli.fna -a/home/amcguire/alignace/lib/ORF_ecoli.txt -b/home/amcguire/alignace/lib/bimes_ecoli.txt -k0 -l300 -jfarR.reg -g0.5 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 182 Input sequences: #1 farR 108 bp farR 240 1-723 CDS Motif number 1 ATACAAATACAATACAAATAATTTCAATCA 1 29 0 AATACAAATA 0.994369 -80 TCCTGTAAATAATACAAATACAATACAAAT 1 40 0 AATACAAATA 0.994369 -69 GTATCTCATTAATACGAATTTAACCATTAT 1 84 0 AATACGAATT 0.750231 -25 GTATTAATGAGATACTAAAA 1 99 1 GATACTAAAA 0.972882 -10 ********** Masking position 4 Map Score: 6.6407 Number of sites scoring better than the average of aligned sites = 32 Number in coding regions = 25 Number in noncoding regions = 7 Number of orfs with sites within 600 bp upstream = 7 Fraction of orfs with sites within 600 bp upstream = 0.00112432 Motif number 2 TATGTGATCAATTTCACTTGATTGAA 1 7 1 ATCAATTTCA 0.984738 -102 ATACAATACAAATAATTTCAATCAAGTGAA 1 23 0 AATAATTTCA 0.990034 -86 TTGTATTTGTATTATTTACAGGATGAATTT 1 47 1 ATTATTTACA 0.929158 -62 CATTATGCCCGATAAATTCATCCTGTAAAT 1 60 0 GATAAATTCA 0.986888 -49 GGGCATAATGGTTAAATTCGTATTAATGAG 1 80 1 GTTAAATTCG 0.979843 -29 ********** Masking position 4 Map Score: 5.67261 Number of sites scoring better than the average of aligned sites = 395 Number in coding regions = 317 Number in noncoding regions = 78 Number of orfs with sites within 600 bp upstream = 107 Fraction of orfs with sites within 600 bp upstream = 0.017186 Motif number 3 ********** No masking Map Score: 1.37435e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: 1.37435e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 1.37435e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0