AlignACE version 2.2 July 7, 1998 alignACE -a/home/amcguire/genomes/ORF_ecoli.txt -z/home/amcguire/genomes/ecoli.fna -iilvY_ecoli_opreg_300.orf -g0.5 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 ilvY 149 positive regulator for ilvC Motif number 1 AATAAGAAGCACAACATCACGAGGAATCAC 1 12 0 ACAACATCAC 0.995358 -138 CGCGAACCGAACAATAAGAAGCACAACATC 1 24 0 ACAATAAGAA 0.918154 -126 GATTGAATTCACTATATGACAGGAAATTTA 1 61 1 ACTATATGAC 0.974552 -89 TGACGTTGTGAATATATCAATTTCCGCAAT 1 90 0 AATATATCAA 0.878246 -60 TGATATATTCACAACGTCACATTGCAATTT 1 101 1 ACAACGTCAC 0.994401 -49 TGCAATTTTTGCAACGTCAACATCGAGGGC 1 123 1 GCAACGTCAA 0.976394 -27 ********** Masking position 4 Map Score: 6.75687 Number of sites scoring better than the average of aligned sites = 1072 Number in coding regions = 974 Number in noncoding regions = 98 Number of orfs with sites within 600 bp upstream = 102 Fraction of orfs with sites within 600 bp upstream = 0.0163829 Motif number 2 TTCGCGTTTGCGAGATTGAATTCACTATAT 1 48 1 CGAGATTGAA 0.984935 -102 CTATATGACAGGAAATTTATTGCGGAAATT 1 72 1 GGAAATTTAT 0.983451 -78 AATTTATTGCGGAAATTGATATATTCACAA 1 85 1 GGAAATTGAT 0.995506 -65 ********** Masking position 5 Map Score: 1.83422 Number of sites scoring better than the average of aligned sites = 72 Number in coding regions = 61 Number in noncoding regions = 11 Number of orfs with sites within 600 bp upstream = 15 Fraction of orfs with sites within 600 bp upstream = 0.00240925 Motif number 3 ********** No masking Map Score: -6.86222e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -6.86222e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -6.86222e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0