AlignACE version 2.2 July 7, 1998 alignACE -a/home/amcguire/genomes/ORF_ecoli.txt -z/home/amcguire/genomes/ecoli.fna -ilacI_ecoli_opreg_100.orf -g0.5 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 lacA 65 thiogalactoside acetyltransferase #2 lacY 51 galactoside permease (M protein) #3 lacZ 122 beta-D-galactosidase Motif number 1 GCAATCAATGTCGGATGCGGCGCGAGCGCCTTA 1 9 1 TGCGATGCGC 0.998064 -57 ATGATATGTTGGTCGGATAAGGCGCTCGCGCCGCA 1 26 0 GGCGATGCGC 0.999124 -40 GGCCATGTCTGCCCGTATTTCGCGTAAGGAAATCC 2 24 1 GCCGATGCGT 0.880687 -28 GTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTT 3 27 1 TCCTATGCAC 0.922454 -96 CATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGG 3 52 0 GGAGATGTGT 0.980784 -71 TATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGA 3 68 1 GCCGATGTGT 0.996702 -55 ** ** ** **** Masking position 8 Map Score: 8.51966 Number of sites scoring better than the average of aligned sites = 1190 Number in coding regions = 747 Number in noncoding regions = 443 Number of orfs with sites within 600 bp upstream = 125 Fraction of orfs with sites within 600 bp upstream = 0.0200771 Motif number 2 TCGGATAAGGCGCTCGCGCCGCATCCGACA 1 19 0 CGCTCGCGCC 0.978247 -47 TGCGATCACTCCGTTATGATAT 1 54 0 CGATCACTCC 0.98972 -12 TAATAACCGGGCAGGCCATGTCTGCCC 2 8 1 CGGGCAGGCC 0.994309 -44 ACGCGAAATACGGGCAGACATGGCCTGCCC 2 19 0 CGGGCAGACA 0.980744 -33 AATGTGAGTTAGCTCACTCATTAGGCACCC 3 24 1 AGCTCACTCA 0.963066 -99 AATTGTTATCCGCTCACAATTCCACACAAC 3 86 0 CGCTCACAAT 0.937591 -37 ********** Masking position 5 Map Score: 4.1622 Number of sites scoring better than the average of aligned sites = 2124 Number in coding regions = 1929 Number in noncoding regions = 195 Number of orfs with sites within 600 bp upstream = 138 Fraction of orfs with sites within 600 bp upstream = 0.0221651 Motif number 3 AATGAGTGAGCTAACTCACATTAATTGCGT 3 16 0 CTAACTCACA 0.980843 -107 TATCCGCTCACAATTCCACACAACATACGA 3 80 0 CAATTCCACA 0.993758 -43 GAGCGGATAACAATTTCACACAGGAAACAG 3 101 1 CAATTTCACA 0.994748 -22 ********** Masking position 3 Map Score: 1.41223 Number of sites scoring better than the average of aligned sites = 34 Number in coding regions = 27 Number in noncoding regions = 7 Number of orfs with sites within 600 bp upstream = 7 Fraction of orfs with sites within 600 bp upstream = 0.00112432 Motif number 4 CCGCATCCGACATTGATTGC 1 1 0 CATTGATTGC 0.996454 -65 TACGGGCAGACATGGCCTGCCCGGTTATTA 2 11 0 CATGGCCTGC 0.993321 -41 AATGGATTTCCTTACGCGAA 2 42 0 AATGGATTTC 0.964957 -10 AGCTAACTCACATTAATTGCGTTGCGC 3 8 0 CATTAATTGC 0.986059 -115 ********** Masking position 3 Map Score: 3.00659 Number of sites scoring better than the average of aligned sites = 314 Number in coding regions = 279 Number in noncoding regions = 35 Number of orfs with sites within 600 bp upstream = 36 Fraction of orfs with sites within 600 bp upstream = 0.0057822 Motif number 5 ********** No masking Map Score: 2.72438e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 2.72438e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 2.72438e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0