AlignACE version 2.2 July 7, 1998 alignACE -a/home/amcguire/genomes/ORF_ecoli.txt -z/home/amcguire/genomes/ecoli.fna -ilacI_ecoli_opreg_300.orf -g0.5 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 lacA 65 thiogalactoside acetyltransferase #2 lacY 51 galactoside permease (M protein) #3 lacZ 122 beta-D-galactosidase #4 lacI 76 transcriptional repressor of the lac operon #5 mhpR 76 transcriptional regulator for mhp operon Motif number 1 GTCGGATGCGGCGCGAGCGCCTTATCCGACCAA 1 20 1 GCGCGAGCTT 0.989639 -46 CCCGTATTTCGCGTAAGGAAATCCATT 2 35 1 GCGTAAGATC 0.969825 -17 GCGCAACGCAATTAATGTGAGTT 3 1 1 GCGCAACATT 0.997282 -122 GGAATTGTGAGCGGATAACAATTTCACACAGGA 3 93 1 GCGGATAATT 0.924889 -30 CCATCGAATGGCGCAAAACCTTTCGCGGTATGG 4 13 1 GCGCAAACTT 0.993774 -64 ATGATAGCGCCCGGAAGAGAGTCAATTCAGGGT 4 47 1 CCGGAAGATC 0.935524 -30 TGTACTGTGCGCGCAACGACATTTTGTCCGAGT 5 25 0 GCGCAACCTT 0.997227 -52 GCACAGTACAGCGCAACTTATTTTGTTAAAAAC 5 48 1 GCGCAACATT 0.997281 -29 ******* * ** Masking position 12 Map Score: 12.1452 Number of sites scoring better than the average of aligned sites = 627 Number in coding regions = 564 Number in noncoding regions = 63 Number of orfs with sites within 600 bp upstream = 76 Fraction of orfs with sites within 600 bp upstream = 0.0122069 Motif number 2 GATAAGGCGCTCGCGCCGCATCCGACATTG 1 16 0 TCGCGCCGCA 0.964606 -50 CCCGTATTTCGCGTAAGGAAATCCATT 2 35 1 GCGTAAGGAA 0.976662 -17 GCGCAACGCAATTAATGTGA 3 1 1 GCGCAACGCA 0.994495 -122 ATGCCATACCGCGAAAGGTTTTGCGCCATT 4 19 0 GCGAAAGGTT 0.888083 -58 TGGCATGATAGCGCCCGGAAGAGAGTCAAT 4 43 1 GCGCCCGGAA 0.982136 -34 TTTGTCCGAGTCGTGAGGTACTGAA 5 6 0 TCGTGAGGTA 0.92318 -71 ATGTCGTTGCGCGCACAGTACAGCGCAACT 5 36 1 GCGCACAGTA 0.981739 -41 GCACAGTACAGCGCAACTTATTTTGTTAAA 5 48 1 GCGCAACTTA 0.960528 -29 ********** Masking position 3 Map Score: 7.29862 Number of sites scoring better than the average of aligned sites = 3007 Number in coding regions = 2815 Number in noncoding regions = 192 Number of orfs with sites within 600 bp upstream = 191 Fraction of orfs with sites within 600 bp upstream = 0.0306778 Motif number 3 CGCGCCGCATCCGACATTGATTGC 1 2 0 CCGCATTGTG 0.969688 -64 TGCGATCACTCCGTTATGATATGTTGGTCGGAT 1 43 0 CCGTATGATG 0.976346 -23 GAAATACGGGCAGACATGGCCTGCCCGGTTATT 2 12 0 CAGCATGGTG 0.682011 -40 CATAAAGTGTAAAGCCTGGGGTGCCTAATGAGT 3 39 0 AAACCTGGTG 0.859113 -84 ATACGAGCCGGAAGCATAAAGTGTAAAGCCTGG 3 53 0 GAACATAATG 0.765536 -70 GAAAGGTTTTGCGCCATTCGATGGTG 4 4 0 GCGCATTCTG 0.956717 -73 AAAACCTTTCGCGGTATGGCATGATAGCGCCCG 4 27 1 GCGTATGGTG 0.984894 -50 ATTCACCACCCTGAATTGACTCTCTTCC 4 59 0 CCACCTGATG 0.965842 -18 *** ***** ** Masking position 7 Map Score: 4.43397 Number of sites scoring better than the average of aligned sites = 1577 Number in coding regions = 1460 Number in noncoding regions = 117 Number of orfs with sites within 600 bp upstream = 95 Fraction of orfs with sites within 600 bp upstream = 0.0152586 Motif number 4 ATAAGGCGCTCGCGCCGCATCCGACATTGA 1 15 0 CGCGCCGCAT 0.959192 -51 TTATGATATGTTGGTCGGATAAGGCGCTCG 1 33 0 TTGGTCGGAT 0.9328 -33 CAGACATGGCCTGCCCGGTTATTA 2 5 0 CTGCCCGGTT 0.985196 -47 CAGGCCATGTCTGCCCGTATTTCGCGTAAG 2 22 1 CTGCCCGTAT 0.991648 -30 TTTATGCTTCCGGCTCGTATGTTGTGTGGA 3 66 1 CGGCTCGTAT 0.991718 -57 CAGTACCTCACGACTCGGACAAAATGTCGT 5 13 1 CGACTCGGAC 0.949778 -64 ********** Masking position 6 Map Score: 3.4435 Number of sites scoring better than the average of aligned sites = 1147 Number in coding regions = 1054 Number in noncoding regions = 93 Number of orfs with sites within 600 bp upstream = 78 Fraction of orfs with sites within 600 bp upstream = 0.0125281 Motif number 5 ********** No masking Map Score: -1.88842e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -1.88842e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -1.88842e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0