AlignACE version 2.2 July 7, 1998 alignACE -z/skink1/amcguire/genomes/ecoli.fna -a/home/amcguire/alignace/lib/ORF_ecoli.txt -b/home/amcguire/alignace/lib/bimes_ecoli.txt -k0 -l300 -jlacI.reg -g0.5 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 182 Input sequences: #1 lacZ 122 bp lacZ 1024 1-3075 CDS Motif number 1 GCGCAACGCAATTAATGTGAGTTAGCTCA 1 8 1 GCAAAATGTG 0.940383 -115 AGCCTGGGGTGCCTAATGAGTGAGCTAACTCA 1 28 0 GCCTTGAGTG 0.994546 -95 CGAGCCGGAAGCATAAAGTGTAAAGCCTGGGG 1 51 0 GCATAGTGTA 0.984601 -72 CTTCCGGCTCGTATGTTGTGTGGAATTGTGAG 1 72 1 GTATTGTGTG 0.997086 -51 ATGTTGTGTGGAATTGTGAGCGGATAACAATT 1 84 1 GAATTGAGCG 0.97438 -39 AGCTGTTTCCTGTGTGAAATTGTTAT 1 107 0 GTTTTGTGTG 0.990477 -16 **** ****** Masking position 10 Map Score: 5.81393 Number of sites scoring better than the average of aligned sites = 681 Number in coding regions = 613 Number in noncoding regions = 68 Number of orfs with sites within 600 bp upstream = 83 Fraction of orfs with sites within 600 bp upstream = 0.0133312 Motif number 2 ACCCCAGGCTTTACACTTTATGCTTCCGGC 1 50 1 TTACACTTTA 0.973125 -73 TGTTATCCGCTCACAATTCCACACAACATA 1 83 0 TCACAATTCC 0.993309 -40 TGTGAGCGGATAACAATTTCACACAGGAAA 1 98 1 TAACAATTTC 0.991405 -25 ********** Masking position 5 Map Score: 0.688411 Number of sites scoring better than the average of aligned sites = 95 Number in coding regions = 69 Number in noncoding regions = 26 Number of orfs with sites within 600 bp upstream = 32 Fraction of orfs with sites within 600 bp upstream = 0.00513974 Motif number 3 ********** No masking Map Score: 1.23224e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: 1.23224e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 1.23224e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0