AlignACE version 2.2 July 7, 1998 alignACE -z/skink1/amcguire/genomes/ecoli.fna -a/home/amcguire/alignace/lib/ORF_ecoli.txt -b/home/amcguire/alignace/lib/bimes_ecoli.txt -k0 -l300 -jmarR.reg -g0.5 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 137 Input sequences: #1 marR 268 bp marR 125 1-378 CDS Motif number 1 GTATCTGGGTTATCAGCGAAAAGTATAAGGGGTAA 1 29 1 TTCAGAAGTA 0.983399 -240 TAGCCTTGCATCGCATTGAACAAAACTTGAACCGA 1 90 1 TGCAGAAAAA 0.978621 -179 TAGCAAAACGTGGCATCGGTCAATTCATTCATTTG 1 127 1 TGCAGGAATT 0.989533 -142 GGGGATAATATTGCCCAGGCAAGTATAAGTCAAAT 1 157 0 TGCCGGAGTA 0.9967 -112 AAGTAATTAGTTGCAGGGGATAATATTGCCCAGGC 1 172 0 TGCAGGAATA 0.995416 -97 TTCACATTAGTTGCCCTGGCAAGTAATTAGTTGCA 1 192 0 TGCCGGAGTA 0.9967 -77 AATGGAATAATTTCATTGAACAGATCGCTGGTACT 1 228 0 TTCAGAAGAT 0.918165 -41 * *** ** **** Masking position 12 Map Score: 9.50671 Number of sites scoring better than the average of aligned sites = 260 Number in coding regions = 230 Number in noncoding regions = 30 Number of orfs with sites within 600 bp upstream = 27 Fraction of orfs with sites within 600 bp upstream = 0.00433665 Motif number 2 GTATCTGGGTTATCAGCGAAAAGTATAAGG 1 29 1 TATCAGCGAA 0.93565 -240 TTAGCTAGCCTTGCATCGCATTGAACAAAA 1 85 1 TTGCATCGCA 0.954933 -184 TAGCAAAACGTGGCATCGGTCAATTCATTC 1 127 1 TGGCATCGGT 0.959759 -142 GACTTATACTTGCCTGGGCAATATTATCCC 1 161 1 TGCCTGGGCA 0.761831 -108 AAGTAATTAGTTGCAGGGGATAATATTGCC 1 177 0 TTGCAGGGGA 0.983473 -92 ACTAATTACTTGCCAGGGCAACTAATGTGA 1 196 1 TGCCAGGGCA 0.569802 -73 ATGTGAAAAGTACCAGCGATCTGTTCAATG 1 220 1 TACCAGCGAT 0.961678 -49 ********** Masking position 1 Map Score: 6.89202 Number of sites scoring better than the average of aligned sites = 2814 Number in coding regions = 2705 Number in noncoding regions = 109 Number of orfs with sites within 600 bp upstream = 123 Fraction of orfs with sites within 600 bp upstream = 0.0197559 Motif number 3 CAAGTTTTGTTCAATGCGATGCAAGGCTAG 1 89 0 TCAATGCGAT 0.940517 -180 AATGAATTGACCGATGCCACGTTTTGCTAA 1 126 0 CCGATGCCAC 0.96926 -143 CTTATACTTGCCTGGGCAATATTATCCCCT 1 163 1 CCTGGGCAAT 0.96413 -106 GCAATATTATCCCCTGCAACTAATTACTTG 1 178 1 CCCCTGCAAC 0.974904 -91 TAATTACTTGCCAGGGCAACTAATGTGAAA 1 198 1 CCAGGGCAAC 0.990723 -71 AGCGATCTGTTCAATGAAATTATTCCATTG 1 234 1 TCAATGAAAT 0.869956 -35 ATTAAGCGACCCAATGGAATAATTTCATTG 1 245 0 CCAATGGAAT 0.973223 -24 ********** Masking position 9 Map Score: 3.55057 Number of sites scoring better than the average of aligned sites = 1445 Number in coding regions = 1353 Number in noncoding regions = 92 Number of orfs with sites within 600 bp upstream = 87 Fraction of orfs with sites within 600 bp upstream = 0.0139737 Motif number 4 TAAAGAGTGACACTTTATCCTTGTTTACCC 1 58 0 CACTTTATCC 0.985768 -211 TAAAGTGTCACTCTTTAGCTAGCCTTGCAT 1 71 1 CTCTTTAGCT 0.974343 -198 AAACTTGAACCGATTTAGCAAAACGTGGCA 1 112 1 CGATTTAGCA 0.945076 -157 TCCATTGGGTCGCTTAATCCAT 1 257 1 CGCTTAATCC 0.893224 -12 ********** Masking position 5 Map Score: 0.916873 Number of sites scoring better than the average of aligned sites = 606 Number in coding regions = 570 Number in noncoding regions = 36 Number of orfs with sites within 600 bp upstream = 46 Fraction of orfs with sites within 600 bp upstream = 0.00738837 Motif number 5 TTCAAGTTTTGTTCAATGCGATGCAAGGCT 1 91 0 GTTCAATGCG 0.991419 -178 ACGTGGCATCGGTCAATTCATTCATTTGAC 1 134 1 GGTCAATTCA 0.966757 -135 GCAAGTATAAGTCAAATGAATGAATTGACC 1 144 0 GTCAAATGAA 0.949105 -125 CCAGCGATCTGTTCAATGAAATTATTCCAT 1 232 1 GTTCAATGAA 0.992207 -37 ********** Masking position 5 Map Score: 1.32603 Number of sites scoring better than the average of aligned sites = 176 Number in coding regions = 159 Number in noncoding regions = 17 Number of orfs with sites within 600 bp upstream = 17 Fraction of orfs with sites within 600 bp upstream = 0.00273049 Motif number 6 ********** No masking Map Score: -2.39152e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -2.39152e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -2.39152e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0