AlignACE version 2.2 July 7, 1998 alignACE -a/home/amcguire/genomes/ORF_ecoli.txt -z/home/amcguire/genomes/ecoli.fna -itorR_ecoli_opreg_300.orf -g0.5 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 torR_torC 129 torR: response transcriptional regulator for torA (sensor TorS), torC: trimethylamine N-oxide reductase, cytochrome c-type subunit Motif number 1 TAATGAGCAAATATGAACAGCGGCACTGGT 1 49 1 ATATGAACAG 0.998974 -81 GCACTGGTCAGGATGAACGGCTTACGGCAG 1 71 1 GGATGAACGG 0.995163 -59 TTACGGCAGAATATGAACAGATATGAACAG 1 92 1 ATATGAACAG 0.998974 -38 ATATGAACAGATATGAACAGAATGAGTAAA 1 102 1 ATATGAACAG 0.998974 -28 ********** Masking position 6 Map Score: 12.7472 Number of sites scoring better than the average of aligned sites = 16 Number in coding regions = 9 Number in noncoding regions = 7 Number of orfs with sites within 600 bp upstream = 5 Fraction of orfs with sites within 600 bp upstream = 0.000803084 Motif number 2 AAGCGATCTTAATGAGCAAATATGAACAGC 1 40 1 AATGAGCAAA 0.995095 -90 TACGGCAGAATATGAACAGATATGAACAGA 1 93 1 TATGAACAGA 0.964848 -37 ATATGAACAGAATGAGTAAAACCCTCTG 1 112 1 AATGAGTAAA 0.991071 -18 ********** Masking position 5 Map Score: 2.32876 Number of sites scoring better than the average of aligned sites = 57 Number in coding regions = 46 Number in noncoding regions = 11 Number of orfs with sites within 600 bp upstream = 15 Fraction of orfs with sites within 600 bp upstream = 0.00240925 Motif number 3 ********** No masking Map Score: 1.58751e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: 1.58751e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 1.58751e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0