AlignACE version 2.2 July 7, 1998 alignACE -z/skink1/amcguire/genomes/ecoli.fna -a/home/amcguire/alignace/lib/ORF_ecoli.txt -b/home/amcguire/alignace/lib/bimes_ecoli.txt -k0 -l300 -jtorR.reg -g0.5 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 182 Input sequences: #1 torR_torC 129 bp torR 230 1-693 CDS torC 390 1-1173 CDS Motif number 1 ATATGAACAGATATGAACAGAATGAGTAAA 1 19 0 ATATGAACAG 0.998974 -111 TTACGGCAGAATATGAACAGATATGAACAG 1 29 0 ATATGAACAG 0.998974 -101 GCACTGGTCAGGATGAACGGCTTACGGCAG 1 50 0 GGATGAACGG 0.995163 -80 TAATGAGCAAATATGAACAGCGGCACTGGT 1 72 0 ATATGAACAG 0.998974 -58 ********** Masking position 6 Map Score: 12.7472 Number of sites scoring better than the average of aligned sites = 16 Number in coding regions = 9 Number in noncoding regions = 7 Number of orfs with sites within 600 bp upstream = 5 Fraction of orfs with sites within 600 bp upstream = 0.000803084 Motif number 2 CAGAGGGTTTTACTCATTCTGTTCATAT 1 9 1 TTTACTCATT 0.990189 -121 TCTGTTCATATCTGTTCATATTCTGCCGTA 1 28 1 TCTGTTCATA 0.96455 -102 GCTGTTCATATTTGCTCATTAAGATCGCTT 1 81 1 TTTGCTCATT 0.994917 -49 ********** Masking position 8 Map Score: 2.32876 Number of sites scoring better than the average of aligned sites = 57 Number in coding regions = 46 Number in noncoding regions = 11 Number of orfs with sites within 600 bp upstream = 15 Fraction of orfs with sites within 600 bp upstream = 0.00240925 Motif number 3 ********** No masking Map Score: 1.58751e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: 1.58751e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 1.58751e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0