AlignACE version 2.2 July 7, 1998 alignACE -a/home/amcguire/alignace/lib/ORF_hinf.txt -z/skink1/amcguire/genomes/hinf.fna -ideoR_hinf_opreg_100.orf -g0.38 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.38 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 HI1116 110 deoxyribose-phosphate aldolase (deoC) Motif number 1 TTTATTTATTCCTTATCTTG 1 1 1 TTTATTTATT 0.994369 -110 GCAAAAATTCTTTATTTTTGACTATGGTTT 1 55 0 TTTATTTTTG 0.990955 -56 TTATTTATGTTTTACCTATTGTAGCAAAAA 1 78 0 TTTACCTATT 0.983953 -33 TTTTCCTCCTTTTATTTATGTTTTACCTAT 1 89 0 TTTATTTATG 0.996325 -22 ********** Masking position 4 Map Score: 7.10566 Number of sites scoring better than the average of aligned sites = 105 Number in coding regions = 69 Number in noncoding regions = 36 Number of orfs with sites within 600 bp upstream = 36 Fraction of orfs with sites within 600 bp upstream = 0.0057822 Motif number 2 TCAACAAGATAAGGAATAAATAAA 1 5 0 AAGGAATAAA 0.976595 -106 CGTAAAACCATAGTCAAAAATAAAGAATTT 1 51 1 TAGTCAAAAA 0.950544 -60 TTTACCTATTGTAGCAAAAATTCTTTATTT 1 68 0 GTAGCAAAAA 0.965647 -43 TACAATAGGTAAAACATAAATAAAAGGAGG 1 85 1 AAAACATAAA 0.913059 -26 TAAATAAAAGGAGGAAAATA 1 101 1 GAGGAAAATA 0.965647 -10 ********** Masking position 6 Map Score: 1.00513 Number of sites scoring better than the average of aligned sites = 1431 Number in coding regions = 1212 Number in noncoding regions = 219 Number of orfs with sites within 600 bp upstream = 187 Fraction of orfs with sites within 600 bp upstream = 0.0300353 Motif number 3 ********** No masking Map Score: -1.46782e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -1.46782e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.46782e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0