AlignACE version 2.2 July 7, 1998 alignACE -a/home/amcguire/alignace/lib/ORF_hinf.txt -z/skink1/amcguire/genomes/hinf.fna -ideoR_hinf_opreg_300.orf -g0.38 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.38 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 HI1116 110 deoxyribose-phosphate aldolase (deoC) Motif number 1 CAAGATAAGGAATAAATAAA 1 1 0 AATAAATAAA 0.993576 -110 AAACCATAGTCAAAAATAAAGAATTTTTGC 1 55 1 CAAAAATAAA 0.989654 -56 TTTTTGCTACAATAGGTAAAACATAAATAA 1 78 1 AATAGGTAAA 0.981682 -33 ATAGGTAAAACATAAATAAAAGGAGGAAAA 1 89 1 CATAAATAAA 0.995814 -22 ********** Masking position 4 Map Score: 7.10566 Number of sites scoring better than the average of aligned sites = 105 Number in coding regions = 69 Number in noncoding regions = 36 Number of orfs with sites within 600 bp upstream = 36 Fraction of orfs with sites within 600 bp upstream = 0.0057822 Motif number 2 TCATCTCAACAAGATAAGGAATAAATAAA 1 10 0 AAGATAAGGA 0.996135 -101 ACCATAGTCAAAAATAAAGAATTTTTGCTA 1 57 1 AAAATAAAGA 0.984557 -54 GTAAAACATAAATAAAAGGAGGAAAATA 1 93 1 AATAAAAGGA 0.989965 -18 ********** Masking position 6 Map Score: 3.06241 Number of sites scoring better than the average of aligned sites = 61 Number in coding regions = 39 Number in noncoding regions = 22 Number of orfs with sites within 600 bp upstream = 24 Fraction of orfs with sites within 600 bp upstream = 0.0038548 Motif number 3 ********** No masking Map Score: -1.46782e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -1.46782e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.46782e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0