AlignACE version 2.2 July 7, 1998 alignACE -a/home/amcguire/genomes/ORF_hpyl.txt -z/home/amcguire/genomes/hpyl.fna -icynR_hpyl_opreg_300.orf -g0.389 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.389 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 HP0004 121 carbonic anhydrase (icfA) Motif number 1 ATTTTACACTTTAAAGGGCTTTC 1 3 0 TTAAAGGCTT 0.9953 -119 TTCTTTTTGTTATAATGGCGTTATTTTACAC 1 25 0 TATAAGGCGT 0.932949 -97 CTTATCATAGCTAAAATTCTTGCATTTCTTT 1 50 0 CTAAATTCTT 0.969504 -72 TCGTTTGTTTTTAAAACGCTTATCATAGCTA 1 68 0 TTAAACGCTT 0.9953 -54 CTCATTTTGATTAAAATTCGTTTGTTTTTAA 1 85 0 TTAAATTCGT 0.989462 -37 TCTTTAACCCTTAAATCTCATTTTGATTAAA 1 101 0 TTAAACTCAT 0.981576 -21 ***** ***** Masking position 5 Map Score: 7.92489 Number of sites scoring better than the average of aligned sites = 629 Number in coding regions = 532 Number in noncoding regions = 97 Number of orfs with sites within 600 bp upstream = 76 Fraction of orfs with sites within 600 bp upstream = 0.0122069 Motif number 2 GAAAGCCCTTTAAAGTGTAAAATAACGCCA 1 11 1 TAAAGTGTAA 0.953514 -111 GCCATTATAACAAAAAGAAATGCAAGAATT 1 37 1 CAAAAAGAAA 0.992757 -85 ATAAGCGTTTTAAAAACAAACGAATTTTAA 1 76 1 TAAAAACAAA 0.970631 -46 GAATTTTAATCAAAATGAGATTTAAGGGTT 1 97 1 CAAAATGAGA 0.98771 -25 ********** Masking position 4 Map Score: 2.1824 Number of sites scoring better than the average of aligned sites = 311 Number in coding regions = 257 Number in noncoding regions = 54 Number of orfs with sites within 600 bp upstream = 48 Fraction of orfs with sites within 600 bp upstream = 0.0077096 Motif number 3 ********** No masking Map Score: -1.46782e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -1.46782e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.46782e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0