AlignACE version 2.2 July 7, 1998 alignACE -a/home/amcguire/genomes/ORF_hpyl.txt -z/home/amcguire/genomes/hpyl.fna -ifhlA_hpyl_opreg_100.orf -g0.389 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.389 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 HP0049 51 H. pylori predicted coding region HP0049 #2 HP0051 174 cytosine specific DNA methyltransferase (DDEM) #3 HP0900 108 hydrogenase expression/formation protein (hypB) Motif number 1 AAACGCTATTTGAATGAGATTGTGTT 1 7 1 TATTTGAATG 0.943873 -45 GTGTTATAGTTATTTAAAAGGATATTTTGA 1 32 1 TATTTAAAAG 0.947897 -20 GCTAGATCCTTTTTTTAAAGCCCTATGACA 2 24 0 TTTTTTAAAG 0.944401 -151 TAATCAAGCGTTTTTGAAACTCCTCTTCGC 2 52 0 TTTTTGAAAC 0.950041 -123 AAAAACGCTTGATTAGAAACATTCTCAATC 2 67 1 GATTAGAAAC 0.819385 -108 GCGCAATTGCGTTTTGAAACCGATGATTTT 2 120 1 GTTTTGAAAC 0.694285 -55 ATTGATCGTATTTGTGAAAGCTTGAA 2 159 1 TTTGTGAAAG 0.975642 -16 CGATACGAAAATTTTAAAAGAAAGGAACAA 3 88 1 ATTTTAAAAG 0.842838 -21 ********** Masking position 7 Map Score: 9.29373 Number of sites scoring better than the average of aligned sites = 1213 Number in coding regions = 1076 Number in noncoding regions = 137 Number of orfs with sites within 600 bp upstream = 109 Fraction of orfs with sites within 600 bp upstream = 0.0175072 Motif number 2 TCAAAATATCCTTTTAAATAACT 1 39 0 AAATATCCTT 0.790066 -13 AGGGCTTTAAAAAAAGGATCTAGCGAAGAG 2 30 1 AAAAAGGATC 0.97693 -145 GAGGAGTTTCAAAAACGCTTGATTAGAAAC 2 57 1 AAAAACGCTT 0.889041 -118 GCTTGATTAGAAACATTCTCAATCGCAATA 2 73 1 AAACATTCTC 0.860456 -102 ATAAGCGTTGAAAAATCATCGGTTTCAAAA 2 131 0 AAAAATCATC 0.977373 -44 AAGCTTTCACAAATACGATCAATAAGCGTT 2 152 0 AAATACGATC 0.901839 -23 TTTTTAGATCAGAAATCCGC 3 1 0 AGAAATCCGC 0.960686 -108 TTCTGATCTAAAAAATCAGCCAAAAAGATA 3 17 1 AAAAATCAGC 0.972705 -92 AAAAAGATAAAAAAAGTCGCTAAATCATAG 3 38 1 AAAAAGTCGC 0.949553 -71 AAATTTTAAAAGAAAGGAACAAC 3 96 1 AGAAAGGAAC 0.790812 -13 ********** Masking position 5 Map Score: 7.84971 Number of sites scoring better than the average of aligned sites = 2413 Number in coding regions = 2186 Number in noncoding regions = 227 Number of orfs with sites within 600 bp upstream = 158 Fraction of orfs with sites within 600 bp upstream = 0.0253774 Motif number 3 ACAATCTCATTCAAATAGCGTTT 1 4 0 TCAAATAGCG 0.955736 -48 TTTAAAAAAAGGATCTAGCGAAGAGGAGTT 2 35 1 GGATCTAGCG 0.975704 -140 AGAATGTTTCTAATCAAGCGTTTTTGAAAC 2 62 0 TAATCAAGCG 0.986118 -113 ACAAATACGATCAATAAGCGTTGAAAAATC 2 144 0 TCAATAAGCG 0.982 -31 TAAACGACTATGATTTAGCGACTTTTTTTA 3 45 0 TGATTTAGCG 0.990143 -64 GTAGCGCACTTAATTAAACGACTATGATTT 3 59 0 TAATTAAACG 0.910548 -50 ********** Masking position 7 Map Score: 5.65442 Number of sites scoring better than the average of aligned sites = 275 Number in coding regions = 240 Number in noncoding regions = 35 Number of orfs with sites within 600 bp upstream = 26 Fraction of orfs with sites within 600 bp upstream = 0.00417604 Motif number 4 ********** No masking Map Score: 3.36387e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 3.36387e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 3.36387e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0