AlignACE version 2.2 July 7, 1998 alignACE -a/home/amcguire/genomes/ORF_hpyl.txt -z/home/amcguire/genomes/hpyl.fna -igcvA_hpyl_opreg_100.orf -g0.389 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.389 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 HP0992 199 H. pylori predicted coding region HP0992 Motif number 1 AAATTTGCTAAACTACAATCAAATCAATTTAGGGA 1 19 0 AATAAAAATC 0.991748 -181 ATAACTAATTAAGTCAAACCAAAACCAACACAAAA 1 51 0 AATAAAAAAC 0.961676 -149 TGACTTAATTAGTTATAAAAGAATAACCAAATTCT 1 70 1 AGTAAGAATA 0.973806 -130 AAGAATAACCAAATTCTACTAAATACATACAAAAT 1 88 1 AATTAAAATA 0.973847 -112 AAGAAATACTAATAACAATTAAATATTAAGTTATT 1 120 0 AAAAAAAATA 0.973839 -80 TATAGCATAGAAATTTAAAGAAATACTAATAACAA 1 137 0 AATAAAAATA 0.994299 -63 AATTCAAGTTAAGTTAAAAGGAATAGAAAA 1 180 1 AATAAGAATA 0.99163 -20 ** * ** ***** Masking position 8 Map Score: 9.38952 Number of sites scoring better than the average of aligned sites = 96 Number in coding regions = 72 Number in noncoding regions = 24 Number of orfs with sites within 600 bp upstream = 27 Fraction of orfs with sites within 600 bp upstream = 0.00433665 Motif number 2 TTATCCTCCCTAAATTGATTTGATTGTAGT 1 13 1 TAAATTGATT 0.932088 -187 GGTTTTGGTTTGACTTAATTAGTTATAAAA 1 60 1 TGACTTAATT 0.959772 -140 TATAAAAGAATAACCAAATTCTACTAAATA 1 83 1 TAACCAAATT 0.956085 -117 CAAATTCTACTAAATACATACAAAATAACT 1 97 1 TAAATACATA 0.889873 -103 ACATACAAAATAACTTAATATTTAATTGTT 1 112 1 TAACTTAATA 0.983406 -88 CATAGAAATTTAAAGAAATACTAATAACAA 1 137 0 TAAAGAAATA 0.890048 -63 CTATTCCTTTTAACTTAACTTGAATTGTAA 1 176 0 TAACTTAACT 0.959772 -24 ********** Masking position 3 Map Score: 4.88356 Number of sites scoring better than the average of aligned sites = 132 Number in coding regions = 77 Number in noncoding regions = 55 Number of orfs with sites within 600 bp upstream = 37 Fraction of orfs with sites within 600 bp upstream = 0.00594282 Motif number 3 TTGCTAAACTACAATCAAATCAATTTAGGG 1 20 0 ACAATCAAAT 0.866957 -180 AAGAATAACCAAATTCTACTAAATACATAC 1 88 1 AAATTCTACT 0.859986 -112 TCTACTAAATACATACAAAATAACTTAATA 1 102 1 ACATACAAAA 0.946752 -98 AAATTTAAAGAAATACTAATAACAATTAAA 1 132 0 AAATACTAAT 0.962952 -68 AATCATTATAGCATAGAAATTTAAAGAAAT 1 148 0 GCATAGAAAT 0.974077 -52 AACTTAACTTGAATTGTAATCATTATAGCA 1 165 0 GAATTGTAAT 0.948327 -35 AAGTTAAAAGGAATAGAAAA 1 190 1 GAATAGAAAA 0.931208 -10 ********** Masking position 3 Map Score: 4.59474 Number of sites scoring better than the average of aligned sites = 427 Number in coding regions = 384 Number in noncoding regions = 43 Number of orfs with sites within 600 bp upstream = 43 Fraction of orfs with sites within 600 bp upstream = 0.00690652 Motif number 4 ********** No masking Map Score: -2.7468e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -2.7468e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -2.7468e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0