AlignACE version 2.2 July 7, 1998 alignACE -a/home/amcguire/genomes/ORF_hpyl.txt -z/home/amcguire/genomes/hpyl.fna -igcvA_hpyl_opreg_300.orf -g0.389 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.389 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 HP0992 199 H. pylori predicted coding region HP0992 Motif number 1 AAATTTGCTAAACTACAATCAAATCAATTTAGGG 1 20 0 AATAACAAAT 0.993786 -180 ATAACTAATTAAGTCAAACCAAAACCAACACAAA 1 52 0 AATAACAAAA 0.990102 -148 TTAGTTATAAAAGAATAACCAAATTCTACTAAAT 1 78 1 AAAAACAAAT 0.983263 -122 AAATTCTACTAAATACATACAAAATAACTTAATA 1 98 1 AATATCAAAA 0.947081 -102 AAGAAATACTAATAACAATTAAATATTAAGTTAT 1 121 0 AAAAATAAAT 0.95202 -79 TATAGCATAGAAATTTAAAGAAATACTAATAACA 1 138 0 AATAAGAAAT 0.988207 -62 CTTTTAACTTAACTTGAATTGTAATCATTATAGC 1 166 0 AATAATGTAA 0.774282 -34 AATTCAAGTTAAGTTAAAAGGAATAGAAAA 1 180 1 AATAAGGAAT 0.979381 -20 ** * ** ***** Masking position 7 Map Score: 10.2295 Number of sites scoring better than the average of aligned sites = 308 Number in coding regions = 225 Number in noncoding regions = 83 Number of orfs with sites within 600 bp upstream = 72 Fraction of orfs with sites within 600 bp upstream = 0.0115644 Motif number 2 TTGGTTTGACTTAATTAGTTATAAAAGAAT 1 64 1 TTAATTAGTT 0.96119 -136 TAGAATTTGGTTATTCTTTTATAACTAATT 1 76 0 TTATTCTTTT 0.729422 -124 TATTTTGTATGTATTTAGTAGAATTTGGTT 1 94 0 GTATTTAGTA 0.981411 -106 AAATATTAAGTTATTTTGTATGTATTTAGT 1 105 0 TTATTTTGTA 0.950023 -95 CTAATAACAATTAAATATTAAGTTATTTTG 1 117 0 TTAAATATTA 0.848345 -83 ATATTTAATTGTTATTAGTATTTCTTTAAA 1 129 1 GTTATTAGTA 0.934525 -71 AACTTGAATTGTAATCATTATAGCATAGAA 1 160 0 GTAATCATTA 0.957261 -40 ********** Masking position 2 Map Score: 4.57624 Number of sites scoring better than the average of aligned sites = 152 Number in coding regions = 110 Number in noncoding regions = 42 Number of orfs with sites within 600 bp upstream = 34 Fraction of orfs with sites within 600 bp upstream = 0.00546097 Motif number 3 GTAGTTTAGCAAATTTTGTGTTGGTTTTGG 1 38 1 AAATTTTGTG 0.9353 -162 AAGAATAACCAAATTCTACTAAATACATAC 1 88 1 AAATTCTACT 0.96425 -112 AATAACAATTAAATATTAAGTTATTTTGTA 1 115 0 AAATATTAAG 0.957255 -85 AAATTTAAAGAAATACTAATAACAATTAAA 1 132 0 AAATACTAAT 0.957252 -68 TATTTCTTTAAATTTCTATGCTATAATGAT 1 147 1 AATTTCTATG 0.956467 -53 ********** Masking position 4 Map Score: 1.40933 Number of sites scoring better than the average of aligned sites = 234 Number in coding regions = 188 Number in noncoding regions = 46 Number of orfs with sites within 600 bp upstream = 46 Fraction of orfs with sites within 600 bp upstream = 0.00738837 Motif number 4 ********** No masking Map Score: -2.7468e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -2.7468e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -2.7468e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0