AlignACE version 2.2 July 7, 1998 alignACE -a/home/amcguire/genomes/ORF_hpyl.txt -z/home/amcguire/genomes/hpyl.fna -iglpR_hpyl_opreg_300.orf -g0.389 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.389 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 HP0654 296 conserved hypothetical protein #2 HP0655 82 protective surface antigen D15 #3 HP0664 37 H. pylori predicted coding region HP0664 Motif number 1 TTAAACCAACACAAAGGAGATACT 1 5 0 ACAAAGGAGA 0.918284 -292 TAATTATAGCATAAATGATAATGAAAAAGT 1 44 1 ATAAATGATA 0.862962 -253 AAAAATTTACAAAAATGAGAAAGAACACCG 1 96 1 AAAAATGAGA 0.976663 -201 AATTAGGTAAAAAAAGGGGTTGGCATCAAT 1 177 1 AAAAAGGGGT 0.935244 -120 AATAGGGGGTTAAAAGGGGATATTTTTATA 1 204 1 TAAAAGGGGA 0.821657 -93 TTTTAGATTTAAGAATGCTTTTTACATATT 1 235 0 AAGAATGCTT 0.903858 -62 TCTTAAATCTAAAAATGCTACAATGTTTAT 1 251 1 AAAAATGCTA 0.982914 -46 AATCATTCTTAAAAACGCTAAAAATTA 2 8 0 AAAAACGCTA 0.974856 -75 TAGCGTTTTTAAGAATGATTAGTTATAATA 2 18 1 AAGAATGATT 0.883109 -65 GATTAGTTATAATAACGCTACTAACAACAC 2 34 1 AATAACGCTA 0.859383 -49 CAATCAGCTTAAAAAGGATATAAA 3 24 1 AAAAAGGATA 0.98294 -14 ********** Masking position 5 Map Score: 12.6688 Number of sites scoring better than the average of aligned sites = 1110 Number in coding regions = 925 Number in noncoding regions = 185 Number of orfs with sites within 600 bp upstream = 164 Fraction of orfs with sites within 600 bp upstream = 0.0263412 Motif number 2 AGTTGTCCCATAATTATAGCATAAATGATA 1 34 1 TAATTATAGC 0.907626 -263 GATAAAGCTTAGATTTTATCATAAAAATCT 1 137 1 AGATTTTATC 0.963097 -160 TTAAAGATAAACATTGTAGCATTTTTAGAT 1 257 0 ACATTGTAGC 0.97713 -40 TAATTTTTAGCGTTTTTAAGA 2 2 1 AATTTTTAGC 0.933612 -81 GCTTGAGTGTTGTTAGTAGCGTTATTATAA 2 40 0 TGTTAGTAGC 0.912542 -43 TTTCCTTAATAGATTTTAGCTTGAGTGTTG 2 58 0 AGATTTTAGC 0.989655 -25 CTTTTTAAGCTGATTGTATCCAATTTCGT 3 10 0 TGATTGTATC 0.969246 -28 ********** Masking position 8 Map Score: 6.48742 Number of sites scoring better than the average of aligned sites = 548 Number in coding regions = 467 Number in noncoding regions = 81 Number of orfs with sites within 600 bp upstream = 73 Fraction of orfs with sites within 600 bp upstream = 0.011725 Motif number 3 CATACTCTCATTTACTTTTTCATTATCATT 1 57 0 TTTACTTTTT 0.94222 -240 CTTGATAAAGCTTAGATTTTATCATAAAAA 1 134 1 CTTAGATTTT 0.93445 -163 ATTCTCATTAAATAGATTTTTATGATAAAA 1 150 0 AATAGATTTT 0.927041 -147 AAGAATGCTTTTTACATATTATATAAAAAT 1 225 0 TTTACATATT 0.863821 -72 TTGTAGCATTTTTAGATTTAAGAATGCTTT 1 244 0 TTTAGATTTA 0.953376 -53 TAAATTGCCCTTTCGTTTTAAAGATAAACA 1 274 0 TTTCGTTTTA 0.890279 -23 TTTAAGAATGATTAGTTATAATAACGCTAC 2 25 1 ATTAGTTATA 0.765506 -58 TGATTTCCTTAATAGATTTTAGCTTGAGTG 2 61 0 AATAGATTTT 0.927041 -22 TTTATATCCTTTTTAAGCTGATTG 3 24 0 TATCCTTTTT 0.807004 -14 ********** Masking position 7 Map Score: 5.67226 Number of sites scoring better than the average of aligned sites = 1025 Number in coding regions = 825 Number in noncoding regions = 200 Number of orfs with sites within 600 bp upstream = 162 Fraction of orfs with sites within 600 bp upstream = 0.0260199 Motif number 4 ATGAGAGTATGAAAATTTTTAAAAATTTAC 1 76 1 GAAAATTTTT 0.710337 -221 TCTCATTTTTGTAAATTTTTAAAAATTTTC 1 86 0 GTAAATTTTT 0.944578 -211 TTCTCATTAAATAGATTTTTATGATAAAAT 1 149 0 ATAGATTTTT 0.887788 -148 GGTTAAAAGGGGATATTTTTATATAATATG 1 211 1 GGATATTTTT 0.961688 -86 ********** Masking position 5 Map Score: 0.813754 Number of sites scoring better than the average of aligned sites = 163 Number in coding regions = 141 Number in noncoding regions = 22 Number of orfs with sites within 600 bp upstream = 18 Fraction of orfs with sites within 600 bp upstream = 0.0028911 Motif number 5 ********** No masking Map Score: -3.17312e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -3.17312e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -3.17312e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0