AlignACE version 2.2 July 7, 1998 alignACE -a/home/amcguire/genomes/ORF_hpyl.txt -z/home/amcguire/genomes/hpyl.fna -inarP_hpyl_opreg_100.orf -g0.389 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.389 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 HP0144 300 cytochrome c oxidase, heme b and copper-binding subunit, membrane-bound (fixN) #2 HP0376 55 ferrochelatase (hemH) #3 HP0377 76 thiol:disulfide interchange protein (dsbC), putative Motif number 1 CATGAAAATACAAAAATAAAGCCAAGCGTT 1 25 1 CAAAAATAAA 0.964784 -276 CGGTGCGCCTAAAAAATACAACAGCGTTGC 1 70 1 AAAAAATACA 0.929054 -231 ATGTTACAGAAAAAGATTAAAAATTAAGCT 1 213 1 AAAAGATTAA 0.988974 -88 ATCTTTTTCAAAAAGCTTAATTTTTAATCT 1 226 0 AAAAGCTTAA 0.954426 -75 AGCTTTTTGAAAAAGATAAAATTTTATAAT 1 239 1 AAAAGATAAA 0.994186 -62 GTAAATTCAACAAAGATAAACATAATTATA 1 263 0 CAAAGATAAA 0.988178 -38 AACGATTAATAAAAAATAAATCGTTAGAAA 2 18 0 AAAAAATAAA 0.982471 -38 TGCTAAAATAAAACGATTAATAAAAAATAA 2 29 0 AAACGATTAA 0.954462 -27 CAAATCTATTAAAAGATAAAGGTTATTAC 3 58 1 AAAAGATAAA 0.994186 -19 ********** Masking position 7 Map Score: 20.964 Number of sites scoring better than the average of aligned sites = 218 Number in coding regions = 178 Number in noncoding regions = 40 Number of orfs with sites within 600 bp upstream = 42 Fraction of orfs with sites within 600 bp upstream = 0.0067459 Motif number 2 TATTTTTGTATTTTCATGGGCATGATTATAGG 1 11 0 TTTTAGGGCA 0.995137 -290 GCTGTTGTATTTTTTAGGCGCACCGGATGGGT 1 63 0 TTTTAGCGCA 0.997459 -238 TCTTGCCCCTTTTTTTATCGCAACGCTGTTGT 1 87 0 TTTTTTCGCA 0.970345 -214 TTGAATGGCATTTTTAAGCCAAATTGCTACTA 1 162 0 TTTTAGCCAA 0.932987 -139 ACTCAATCCCATTTGAATGGCATTTTTAAGCC 1 174 0 ATTTATGGCA 0.944759 -127 AATAATCGCTTTTTTATGCGCATTTTA 3 6 0 TTTTAGCGCA 0.997458 -71 **** * ***** Masking position 4 Map Score: 7.37576 Number of sites scoring better than the average of aligned sites = 374 Number in coding regions = 353 Number in noncoding regions = 21 Number of orfs with sites within 600 bp upstream = 17 Fraction of orfs with sites within 600 bp upstream = 0.00273049 Motif number 3 GCTTGGCTTTATTTTTGTATTTTCATGGGC 1 22 0 ATTTTTGTAT 0.794292 -279 TTAGCCAAAGATAGTAGCAATTTGGCTTAA 1 151 1 ATAGTAGCAA 0.923802 -150 TTTCTGTAACATTGTAATAACTCAATCCCA 1 195 0 ATTGTAATAA 0.928509 -106 AATACTCCTATTTGTAGTAAATTCAACAAA 1 279 0 TTTGTAGTAA 0.973892 -22 AACGATTTATTTTTTATTAATCGTTTTATT 2 23 1 TTTTTATTAA 0.739809 -33 TAATCGTTTTATTTTAGCATGCACCA 2 40 1 ATTTTAGCAT 0.925341 -16 AAAAGCGATTATTGTAGTAAGATACCTAGT 3 25 1 ATTGTAGTAA 0.988477 -52 ********** Masking position 9 Map Score: 4.25068 Number of sites scoring better than the average of aligned sites = 219 Number in coding regions = 147 Number in noncoding regions = 72 Number of orfs with sites within 600 bp upstream = 75 Fraction of orfs with sites within 600 bp upstream = 0.0120463 Motif number 4 TTTTCATGGGCATGATTATAGG 1 3 0 CATGATTATA 0.982871 -298 TAATCATGCCCATGAAAATACAAAAATAAA 1 15 1 CATGAAAATA 0.921486 -286 CATGAAAATACAAAAATAAAGCCAAGCGTT 1 25 1 CAAAAATAAA 0.806552 -276 AAAGGTTAAACATGATTAAACAAACCCTCA 1 123 0 CATGATTAAA 0.987715 -178 TGTTACAGAAAAAGATTAAAAATTAAGCTT 1 214 1 AAAGATTAAA 0.820049 -87 CAAAGATAAACATAATTATAAAATTTTATC 1 253 0 CATAATTATA 0.924302 -48 TGGTGCATGCTAAAATAAAACGATT 2 41 0 CATGCTAAAA 0.915329 -15 ********** Masking position 8 Map Score: 6.22642 Number of sites scoring better than the average of aligned sites = 421 Number in coding regions = 380 Number in noncoding regions = 41 Number of orfs with sites within 600 bp upstream = 36 Fraction of orfs with sites within 600 bp upstream = 0.0057822 Motif number 5 TTGTATTTTCATGGGCATGATTATAGG 1 8 0 ATGGGCATGA 0.996683 -293 CGATAAAAAAAGGGGCAAGAATGATGAGGG 1 99 1 AGGGGCAAGA 0.985872 -202 TGCCATTCAAATGGGATTGAGTTATTACAA 1 184 1 ATGGGATTGA 0.967681 -117 TAAAATGCGCATAAAAAAGCGATT 3 5 1 ATGCGCATAA 0.965771 -72 ********** Masking position 1 Map Score: 1.78498 Number of sites scoring better than the average of aligned sites = 219 Number in coding regions = 210 Number in noncoding regions = 9 Number of orfs with sites within 600 bp upstream = 4 Fraction of orfs with sites within 600 bp upstream = 0.000642467 Motif number 6 ********** No masking Map Score: 7.76924e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 7.76924e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: 7.76924e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0