AlignACE version 2.2 July 7, 1998 alignACE -a/home/amcguire/genomes/ORF_mgen.txt -z/home/amcguire/genomes/mgen.fna -iphoB_mgen_opreg_300.orf -g0.317 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.317 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 MG289 300 high affinity transport system protein P37 Motif number 1 AAGTTACAAACGAAATTGAATTTGTTTAAAACT 1 10 1 AAATTGAATT 0.997427 -291 GAGTTAGAATATAATGTTAAATTTTCCCTGTCTG 1 48 0 AATTTAAATT 0.912564 -253 AATTCAAAAAAGTAATTCGGATCTTAAAAAATAT 1 111 1 AAATCGGATT 0.973475 -190 ATTAATTGCCAGCAACTTGAATCTAAGTAATAAA 1 157 1 AAATTGAATT 0.997426 -144 GAATCTAAGTAATAAAGTGAATATTTATTTTTAT 1 175 1 AAAGTGAATT 0.991685 -126 AAAATAGACTACAAATTTGAATATAAGTTTTTAA 1 208 0 AAATTGAATT 0.997425 -93 AACTAATATAAAAAAGTTGAATATTTAAAAACAA 1 243 1 AAATTGAATT 0.997426 -58 * ** ****** * Masking position 4 Map Score: 14.3838 Number of sites scoring better than the average of aligned sites = 20 Number in coding regions = 13 Number in noncoding regions = 7 Number of orfs with sites within 600 bp upstream = 5 Fraction of orfs with sites within 600 bp upstream = 0.000803084 Motif number 2 TTCAATTTCGTTTGTAACTT 1 1 0 TTTGTAACTT 0.84206 -300 TCTGTTTTAGTTTTAAACAAATTCAATTTC 1 22 0 TTTTAAACAA 0.931388 -279 CGAATTACTTTTTTGAATTAAAGCTATTCT 1 100 0 TTTTGAATTA 0.922962 -201 TAAAAAATATTTTTTAAGATCCGAATTACT 1 121 0 TTTTTAAGAT 0.930137 -180 TAAAAAATATTTTTTAATAAAGATTAATTG 1 135 1 TTTTTAATAA 0.750189 -166 TGAATATAAGTTTTTAATAAAAATAAATAT 1 195 0 TTTTTAATAA 0.750189 -106 TTGTAGTCTATTTTTAACTAATATAAAAAA 1 228 1 TTTTTAACTA 0.970816 -73 AATATTCAACTTTTTTATATTAGTTAAAAA 1 238 0 TTTTTTATAT 0.860852 -63 AATTAATTGTTTTTAAATATTCAACTTTTT 1 253 0 TTTTAAATAT 0.932999 -48 TAATCCTGGATTATTAATTATCAAAATTAA 1 277 0 TTATTAATTA 0.713291 -24 ********** Masking position 7 Map Score: 14.6372 Number of sites scoring better than the average of aligned sites = 673 Number in coding regions = 586 Number in noncoding regions = 87 Number of orfs with sites within 600 bp upstream = 47 Fraction of orfs with sites within 600 bp upstream = 0.00754899 Motif number 3 TGAATTTGTTTAAAACTAAAACAGACAGGG 1 27 1 TAAAACTAAA 0.958882 -274 TCTGAATAGCAAAAAATATAAGAATAGCTT 1 80 1 AAAAAATATA 0.945935 -221 TTTTTTGAATTAAAGCTATTCTTATATTTT 1 92 0 TAAAGCTATT 0.823522 -209 CTTTAATTCAAAAAAGTAATTCGGATCTTA 1 107 1 AAAAAGTAAT 0.797411 -194 TTCGGATCTTAAAAAATATTTTTTAATAAA 1 126 1 AAAAAATATT 0.9231 -175 TATTTTTTAATAAAGATTAATTGCCAGCAA 1 142 1 TAAAGATTAA 0.846368 -159 AAGTTTTTAATAAAAATAAATATTCACTTT 1 188 0 TAAAAATAAA 0.979542 -113 TTATTTTTATTAAAAACTTATATTCAAATT 1 199 1 TAAAAACTTA 0.822543 -102 TTATATTAGTTAAAAATAGACTACAAATTT 1 224 0 TAAAAATAGA 0.945991 -77 GTTGAATATTTAAAAACAATTAATTTTGAT 1 258 1 TAAAAACAAT 0.933655 -43 ********** Masking position 4 Map Score: 9.61817 Number of sites scoring better than the average of aligned sites = 776 Number in coding regions = 663 Number in noncoding regions = 113 Number of orfs with sites within 600 bp upstream = 57 Fraction of orfs with sites within 600 bp upstream = 0.00915516 Motif number 4 AGTTTTAAACAAATTCAATTTCGTTTGTAA 1 14 0 AAATTCAATT 0.97613 -287 TTTATTACTTAGATTCAAGTTGCTGGCAAT 1 161 0 AGATTCAAGT 0.98097 -140 ATAAAAATAAATATTCACTTTATTACTTAG 1 179 0 ATATTCACTT 0.979083 -122 TTAAAAACTTATATTCAAATTTGTAGTCTA 1 208 1 ATATTCAAAT 0.982953 -93 TTGTTTTTAAATATTCAACTTTTTTATATT 1 247 0 ATATTCAACT 0.988483 -54 ********** Masking position 5 Map Score: 6.14826 Number of sites scoring better than the average of aligned sites = 29 Number in coding regions = 27 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 5 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0